Articles

 

Articles

Page 5 of 1131, showing 50 records out of 56523 total, starting on record 201, ending on 250

July 2018

African Journal of Microbiology Research
Identification and molecular phylogeny analysis using random amplification of polymorphic DNA (RAPD) and 16SrRNA sequencing of N2 fixing tea field soil bacteria from North Bengal tea gardens

Random amplification of polymorphic DNA (RAPD) amplification genomic DNA of 23 selected laboratory cultures of bacteria using RAPD revealed their polymorphism. Polymerase chain reaction (PCR) amplification of the bacterial 16SrDNA was performed using 704F GTAGCGGTGAAATGCGTAGA and 907R CCGTCAATTCCTTTGAGTTT primer, sequenced and accessed in NCBI (No. KY636356, KY631488, KY 860028, KX587470, KX665547, KY631489, KX608591,...

Author(s): Jayanta Bhaduri, Pritam Kundu and Subhash Kanti Roy  

July 2018

African Journal of Agricultural Research
Thorn apple (Datura stramonium L.) allelopathy on cowpeas (Vigna unguiculata L.) and wheat (Triticum aestivum L.) in Zimbabwe

Datura stramonium extracts have allelopathic properties. The study was conducted to investigate the allelopathic effects of D. stramonium weed on seed germination, early seedling growth and dry biomass of crop plants (Triticum aestivum and Vigna unguiculata). Laboratory and greenhouse trials were arranged as completely randomised design and the field pot experiment was arranged as a randomised complete block design....

Author(s): Nyasha Sakadzo, Pahla Innocent, Muzemu Simbarashe, Mandumbu Ronald and Makaza Kasirayi  

July 2018

African Journal of Agricultural Research
Analysis of coffee quality along the coffee value chain in Jimma zone, Ethiopia

This study assesses the effect of cooperative, certification, private trader, farmers, sorting and processing methods on Arabica coffee quality. Coffee samples were collected from certified cooperatives, non-certified cooperatives, private traders and farmers (members of certified cooperatives, non-certified cooperatives and non-members of cooperatives). The study showed that coffee beans sampled from cooperatives had...

Author(s): Kassaye Tolessa, Luc Duchateau and Pascal Boeckx  

July 2018

African Journal of Agricultural Research
Sensor-based algorithms to improve barley nitrogen efficiency in Queensland

The low efficiency of nitrogen (N) fertilizers impels the innovation of current N management strategies in cereal production. Site specific N management is an emerging field providing novel alternatives to current nutrient management practices through canopy sensing. Barley N use efficiency can be enhanced with GreenSeeker proximal sensors, whose optimal utilization requires algorithms. The design of such algorithms...

Author(s): Paul Theophile Epee Misse, and Madan Gupta  

July 2018

African Journal of Agricultural Research
Screening of cowpea (Vigna unguiculata (L.) Walp.) lines for resistance to three Aphids (Aphis craccivora Koch) strains in Burkina Faso

Cowpea (Vigna unguiculata L. Walp.) is an important cash, food and nutritional security grain legume crop in the semi-arid regions of sub-Saharan Africa. However, its productivity is hampered by several biotic stress factors including numerous insect pests that infest and damage the crop at all its development stages in the field as well as during storage. This study sought to identify new sources of resistance to...

Author(s): Adelaїde P. Ouédraogo, Benoit J. Batieno, Fousseni Traore, Jean-Baptiste Tignegre, Bao-Lam Huynh, Philip A. Roberts, Timothy Close and Jeremy T. Ouédraogo  

July 2018

African Journal of Biotechnology
Rapid and efficient plant regeneration from shoot apical meristems of finger millet [Eleusine coracana (L.) Gaertn.] via direct organogenesis

A simple and efficient plant regeneration system via direct organogenesis was established in finger millet using in vitro derived shoot apical meristems. Six varieties; GBK-043128, GBK-043094, GBK-043050, GBK-043137, GBK-043122 and GBK-043124 were evaluated. MS medium was used for cotyledonary germination. Maximum number of shoots (84.33%) was observed in variety GBK-043128 while GBK-043094 had the least germination...

Author(s): Asunta Mukami, Alex Ngetich, Cecilia Mweu, Mutemi Muthangya, Richard O. Oduor, Mathew Ngugi and Wilton Mbinda  

July 2018

African Journal of Biotechnology
Assessment of morphological characteristics among upland rice (Oryza sativa and Oryza glaberrima) germplasm

Rice is an important staple food crop that feeds over half of the global population and has become the cereal that provides a major source of calories for the urban and rural poor in Africa. This work aimed to evaluate the morphological of rice (Oryza sativa and Oryza glaberrima) germplasm. In the present study, 14 quantitative traits were used across 48 accessions or genotypes obtained from Central Agricultural...

Author(s): Zogbo Luther, Richard Akromah, David P. Tokpah and Zipporah Page  

July 2018

International Journal of Physical Sciences
Theoretical models for prediction of methane production from anaerobic digestion: A critical review

This work presents a critical analysis for three models group of methanogen potential prediction. The first group allows determination of the methane productivity of substrates, through three models (BMPthCOD, BMPthAtC and BMPthOFC). The BMPthCOD is suitable for a first approximation calculation. BMPthAtC and BMPthOFC are more accurate; however, require a complex characterization of substrates. The second models group...

Author(s): Mohamed Mahmoud ALI, Nourou DIA, Boudy BILAL and Mamoudou NDONGO  

July 2018

Scientific Research and Essays
Indigenous knowledge on highland bamboo (Yushania alpina) management and utilization practices in Kokosa Woreda, South East Ethiopia

Bamboo is one of the world’s most important non-timber forest products (NTFPs) which have been advocated for poverty alleviation in many regions. However, in Ethiopia it is utilized below its potential due to lack of scientific knowledge and awareness on its management and utilization. Therefore, the main objective of this study was to investigate the indigenous knowledge of highland bamboo management and...

Author(s): Seyoum Gebrekidan, Lemma Tiki and Yigardu Mulatu  

July 2018

African Journal of Business Management
Diversity management discourse: An African perspective

This paper reviews the concept of diversity across selected sub-Saharan Africa countries. It focuses on the impact of social relations that depict cultural and social identities of individuals within these African countries. This is with the aim to help corporations develop diversity management strategies for their workforce. Consequently, this narrative paper adopts a qualitative approach, a literature survey that...

Author(s): Loliya Akobo and Osikwemhe Damisah  

July 2018

African Journal of Business Management
Attaining competitive advantage through energy efficiency: A cooperative strategic perspective

The Kenyan economy in the recent past has witnessed a considerable exit of multinational companies due to high-energy costs. Similarly, a comparative analysis among the East African community partners places the country among the list of those nations with high-energy charges levied on consumers. This phenomenon disadvantages the competitiveness of local industries while discouraging potential players. This is...

Author(s): Kiptum Henry Yatich  

July 2018

African Journal of Business Management
Prototyping an innovative e-platform of financial assistance for small medium enterprises in Mauritius

The SMEs form a vibrant pillar of the Mauritian economy through their important contribution to Gross Domestic Product (GDP) growth and socio-economic development. SMEs are recognized for their significance and their resilience in responding to fast changing conditions, even in times of the economic downturn. This paper aims to address financial illiteracy among Mauritian SMEs by proposing an integrated financial...

Author(s): Padachi K., Narrainen D. and Boolaky A.  

July 2018

African Journal of Microbiology Research
Isolation of bacterial diversity present in medical waste and health care settings in hospitals in Kenya

Nosocomial infections have impacted great burden in healthcare system and has led to deteriorating health condition and deaths. This study characterizes medically important bacterial diversity, isolated from staff hands, hospital surfaces and wastes in healthcare settings in Kenya during a one year period. Descriptive cross sectional hospital based study design and simple random sampling method was used to collect 246...

Author(s): Susan Muthoni Maina, Andrew K. Nyerere and Caroline Wangari Ngugi  

July 2018

African Journal of Microbiology Research
Fungal endophytes isolated from the leaves of a medicinal plant, Ocimum sanctum Linn and evaluation of their antimicrobial activities

The endophytic fungi isolated from leaves of Ocimum sanctum Linn. of different ages were examined for antimicrobial activity. The agar plug diffusion assay was used for primary screening. A total of 148 fungal endophytes were successfully isolated and cultured but only 134 of them (90.5%) exhibited inhibitory activity towards at least one test microorganisms. Moreover, the colonization rate indicated that the old leaves...

Author(s): Taufiq M. M. J. and Darah I.  

July 2018

African Journal of Microbiology Research
Microbiological quality of fruit juices sold in cafes and restaurants of Shewarobit town, Amhara, Ethiopia

Fresh and unpasteurized fruit juice is common in restaurants, cafeteria, hotels and juice house of Ethiopian cities. Most fruit juices contain sufficient nutrients that could support microbial growth. The current investigation was carried out to investigate the microbiological quality and processing conditions of fruit juice vended in Shewarobit town. Purposive sampling technique was employed to collect sixteen fruit...

Author(s): Bulti Kumera Fufa and Melkam Dessalegn Liben  

July 2018

African Journal of Agricultural Research
Technical efficiency and yield gap of smallholder wheat producers in Ethiopia: A Stochastic Frontier Analysis

Improving technical efficiency of smallholder farmers is one of the options to increase wheat yield in developing countries. This paper assesses technical efficiency, factors for inefficiency and the yield gap due to technical inefficiency in major wheat producing regions of Ethiopia, where the support to agricultural research for development of strategic crops (SARD-SC) wheat project has been implemented using primary...

Author(s): Tadele Mamo, Wudineh Getahun, Ali Chebil, Agajie Tesfaye, Tolessa Debele, Solomon Assefa and Tesfaye Solomon  

July 2018

African Journal of Agricultural Research
Direct shoot regeneration from hypocotyl explants of Heracleum candicans Wall: A vulnerable high value medicinal herb of Kashmir Himalaya

Heracleum candicans belongs to the family Apiaceae, and is categorized as a vulnerable Himalayan medicinal herb. Due to its diverse chemical constituents it is having an increased demand in pharmaceutical industries, especially in international market. This herb is commercially useful as a major source of Xanthotoxin which is widely used to treat leucoderma and to prepare suntan lotions. During the present study direct...

Author(s): Mahroofa Jan, Seema Singh, Farhana Maqbool and Irshad Ahmad Nawchoo  

July 2018

African Journal of Agricultural Research
Use of millimeter ruler as an alternative tool in the phenotyping of potential descriptors of soybean

The soybean stands out in the Brazilian agribusiness and part of this success stems from the development of improved cultivars. One of the requirements for the concession of protection to a given cultivar is that it should be distinct from others cultivars. Potential additional descriptors of soybean have been studied. Thus, the aim of this study was to evaluate the performance of the millimeter ruler in the measurement...

Author(s): Ronaldo Machado Junior, Guilherme Ferreira Alves, Victor Afonso Reis Gonçalves, Sylas Clemente Oliveira, Ronaldo Silva Gomes, Paulo Roberto Cecon, Silvana da Costa Ferreira and Eder Matsuo  

July 2018

African Journal of Agricultural Research
Screening for resistance to Striga gesnerioides and estimation of yield loss among Cowpea (Vigna unguiculata (L.) Walp.) progenies in the Upper East Region of Ghana

Parasitic weed Striga gesnerioides (Willd.) is one of the major constraints of cowpea production. Host-plant resistance seems to be efficient and economical in controlling the pest. The objectives of this study were to evaluate recombinant inbred lines developed between IT97K 499-35 (Striga resistant parent,) and Sanzi (susceptible parent), by Single Seed Descent (SSD), for Striga resistance in Northern Ghana. The study...

Author(s): Leandre, S. P., Francis, K., Richard, A., Joseph, B., Jean Baptiste T, Jeremy T. Ouedraogo, Patrick A., Timothy J. Close and Philip A. Roberbs

July 2018

African Journal of Agricultural Research
Cultivation of common bean with the application of biochar of ouricuri (Syagrus coronata (Mart) Becc.) endocarp

Biochar has attracted the attention of the scientific community due to its promising applicability and contribution to the elevation of soil chemical and biological aspects, directly influencing the microbiota, fertility levels and yield of agricultural crops. The objective of this study is to determine the chemical and biological attributes of an acrisol cultivated with beans and submitted to the application of...

Author(s): Felipe Alexandre Tenório, Abel Washington De Albuquerque, Tania Marta Carvalho Dos Santos, João Inácio Soletti, Ferdnando Mariano Brito Silva and Karoline De Melo Padilha  

July 2018

African Journal of Agricultural Research
Greenhouse gas emissions from an alkaline saline soil amended with urea: A laboratory study

Soil of the former lake Texcoco is nitrogen (N) depleted, so any attempt to vegetate the area will require the application of an N fertilizer. Urea is commonly used as fertilizer, but its application to soil might affect emissions of greenhouse gases (GHG), such as carbon dioxide (CO2), nitrous oxide (N2O) and methane (CH4), and the high pH and electrolytic conductivity (EC) in the Texcoco soil might inhibit the...

Author(s): César Valenzuela-Encinas, Leslie Elizalde Contreras, Rocio J. Alcántara-Hernández, Marco Luna-Guido, Olivia Franco-Hernández, Víctor M. Ruíz-Valdiviezo, Luc Dendooven and Rodolfo Marsch  

July 2018

African Journal of Biotechnology
Potential evaluation of Saccharomyces cerevisiae strains from alcoholic fermentation of mango pulp

The fermentation characteristics of different strains of Saccharomyces cerevisiae isolated from sugar cane musts for the production of cachaça (Brazilian sugar cane spirit) and from beer musts were analyzed based on the kinetic parameters of alcoholic fermentation in mango pulp. The commercial pressed baker’s yeast was used as a standard inoculum. The results show that the yeast strains tested from sugar...

Author(s): Cosme Damião Barbosa, Inayara Cristina Alves Lacerda and Evelyn de Souza Oliveira

July 2018

African Journal of Biotechnology
Effects of aqueous seed extracts of Mucuna sloanei (Fabaceae) on body weight and some biochemical parameters of Rattus novergicus

Mucuna sloanei is an annual leguminous plant widely used among the various ethnic groups in Nigeria. The effects of aqueous M. sloanei seed extract on the body weight and some biochemical parameters of 48 normal male Rattus novergicus (albino rats) were investigated for 28 days. The rats were divided into control group (A) which received distilled water and treatment groups (B, C and D) that received oral administration...

Author(s): Ugwu, Godwin C., Ejere, Vincent C., Okanya, Chinagorom L., Omeje, Joy N., Egbuji, Jude V., Onu, Martina C. and Chukwuka, Christian O.

July 2018

African Journal of Biotechnology
Effect of seasonal variations on the yield of essential oil and antioxidant of Achillea fragrantissima (Forssk) Sch. Bip

Temperature stress is becoming the major concern for plant scientists worldwide due to climate change. Temperature stress has devastating effects on plant growth and metabolism. The aim of the study was to investigate the effect of climatic seasonal change on the yield and composition of essential oil of the plant, Achillea fragrantissima. The gas chromatography-mass spectrometry (GC-MS) used to analyze the essential...

Author(s): Eman Elsharkawy, and Nour El-Din M. Nahed

July 2018

Educational Research and Reviews
An analysis on play and playmate preferences of 48 to 66 months old children in the context of gender

This research was conducted to analyze play and playmate preferences of preschool girls and boys during free play time. The study group consisted of 48-66 months old preschool children. There were ten girls, seven boys and a preschool teacher in the study group. They were all selected from a public preschool in Cukurova, a district of Adana a city in the south of Turkey in the fall semester of 2014 to 2015 academic...

Author(s): Işıl Taş

July 2018

Educational Research and Reviews
The effect of physical education and sports departments on behavioral changes towards exercising

This study was conducted to investigate the effects of Physical Education and Sports (PES) Departments over the exercise behaviors of male students (277 pu, 283 pri) from a sample group of 21 to 26 year-olds, who are studying in various departments from both private and public universities in Istanbul. The Physical Activity Stages of Change Questionnaire (PASCQ) was used for data collection and the effect of the PES...

Author(s): Aliye Menevşe

July 2018

Educational Research and Reviews
Comparative study of Turkey and Germany Life Science teaching programs

Comparative education studies within the perspective of globalization are seen as important studies, as they reveal the problems in education and show defective aspects of the systems applied in other countries. This way they improve the available system. The purpose of this research is to study the current curriculum of Life Science lesson within the context of four main elements comparatively. The Life Science lesson,...

Author(s): Tuncay Canbulat

July 2018

Educational Research and Reviews
Existential intelligence among graduate students at the World Islamic Sciences University in Jordan

Existential intelligence is often neglected in literature, especially at the tertiary level. Therefore this study aims to identify the degree of existential intelligence in a sample of graduate students at the World Islamic Sciences University in Jordan. In addition, the study aims to find out whether this degree differs according to a number of variables. The study sample comprised 56 male and female Faculty of...

Author(s): Esam Abdullah Al Jaddou  

July 2018

Journal of Medicinal Plants Research
Evaluation of Procavia capensis hyraceum used in traditional medicine for antioxidant activity

Hyraceum (HM) used in traditional medicine in Southern Africa is produced by the herbivore Procavia capensis. It is fossilized excreta derived from urine, faecal matter and plant material. In this study a qualitative phytochemical screening, determination of the in vitro antioxidant activity using the 1, 1-Diphenyl-2-picrylhydrazyl (DPPH) and hydrogen peroxide scavenging methods, and determination of the total phenolic...

Author(s): Sibusisiwe Magama, Thabang Rants’o, Asita Okorie Asita and Matsepo Taole  

July 2018

Journal of Medicinal Plants Research
Towards accomplishing the roll back malaria initiative: Phytochemical screening and antimalarial activity of ethanolic leaf extract of Ricinus communis L. (Euphorbiaceae)

Malaria is a major debilitating disease caused by Plasmodium species and spread by female Anopheles mosquitoes. This research was conducted to determine the efficacy of ethanolic leaf extracts of Ricinus communis L. against Plasmodium berghei (NK65) infection in mice. Phytochemical components of the extract were analyzed and elucidated in order to reveal the constituents with antimalarial potentials. The safety of the...

Author(s): Abdulhamid Ahmed, Mansur Liadi Yusuf, Sulaiman Sani Kankara and Umar Lawal  

July 2018

Journal of Medicinal Plants Research
Spermostatic activity of Eugenia brejoensis and Myroxylon peruiferum essential oils toward human spermatozoa

In this study, the in vitro spermostatic action, hemolytic action in combination of parabens of two essential oils (EOs) from Eugenia brejoensis Mazin (Myrtaceae, EbEO) and Myroxylon peruiferum L. (Fabaceae, MpEO) is reported, in addition to the first chemical characterization of MpEO. The EOs were obtained by hydrodistillation and characterized by gas chromatography-mass spectrometry (GC-MS). Different concentrations...

Author(s): José Adelson Alves do Nascimento Junior, Clovis Macêdo Bezerra Filho, Thiago Henrique Florencio de Oliveira, Alexandre Gomes da Silva, Patricia Cristina Bezerra-Silva, Patricia Maria Guedes Paiva, Marcia Vanusa da Silva, Daniela Maria do Amaral Ferraz Navarro, Luis Claudio Nascimento da Silva, and Maria Tereza dos Santos Correia,

July 2018

African Journal of Pharmacy and Pharmacology
Antioxidant activity of selenium on bisphenol-induced apoptosis and testicular toxicity of rats

Bisphenol A (BPA) is an industrial chemical widely used to make polycarbonate plastics for packaging and epoxy resins. This study sought to examine how selenium (Se) affects BPA toxicity in terms of albino rats’ histological structure, antioxidant enzymes, sexual hormones, and reproductive organs (seminiferous tubule (coiled tubule) diameter, epithelial height and sperm count). Adult male rats were divided into...

Author(s): Wael M. Al-Amoudi  

July 2018

African Journal of Pharmacy and Pharmacology
Hypoglycemic, hypolipidemic and kidney protective potential of combined formulation of Tribulus terrestris and Andrographis paniculata in alloxan induced mice

The study aims to evaluate the effect of Tribulus terrestris and Andrographis paniculata on body weight, blood glucose, lipid profile and renal protective capability in alloxan induced type-1 diabetic mice. Six groups of five male Swiss Albino mice each, at four weeks of age were used in this experiment. Group-X were fed saline water and Group-Y with combined herbal formulation at a high dose (1 g/kg bwt) to asses...

Author(s): Istiak A., Hazra P., Das S. R., Hossain M. I., Aminatu A. S., and Rafiq K.  

July 2018

African Journal of Microbiology Research
Determination of aflatoxin M1 in bovine milk from the Alagoas/Brazil State dairy belt by high performance liquid chromatography (HPLC)

Milk is considered a nutritionally noble food and is therefore suitable for feeding children and adults. However, contamination of milk by mycotoxins may pose a health risk to the consumer. Aflatoxins, mycotoxins produced by fungi of the genus Aspergillus, can be found in several food products, including milk and its derivatives, which reinforces the importance of this type of study on the occurrence of the aflatoxin M1...

Author(s): Angela Matilde da Silva Alves, Pabllo Henrique de Souza Lima, Mario Alberto Santos da Costa, Cristian Bernardo da Silva, Jonas dos Santos Sousa, Danielle dos Santos Tavares Pereira, Phabyanno Rodrigues Lima and Johnnatan Duarte de Freitas

July 2018

African Journal of Microbiology Research
Microbiological quality and safety of milk production and marketing in Hawassa district, Ethiopia

The microbiological quality and safety of milk samples from different sources in Hawassa distinct from southern nations, nationalities and people regional state was evaluated.  A total of 63 raw milk samples were obtained from three selected dairy farms, urban and rural households. Twenty-seven pasteurized milk samples were obtained from three retail brands from various supermarkets in Hawassa city. Each milk...

Author(s): Habtamu Korma, Ajebu Nurfeta and Edessa Negera

July 2018

African Journal of Microbiology Research
Differential niche occupation and the biotechnological potential of Methylobacterium species associated with sugarcane plants

This work highlighted a putative link between the physiological activity and genetic diversity of Methylobacterium species and the association with sugarcane roots and rhizoplane. In total, 40 isolates previously described as pink-pigmented facultative methylotrophic bacteria (PPFMs), were evaluated for their ability to fix nitrogen and solubilize inorganic phosphate, amylase and pectinase activity. This in vitro...

Author(s): Pedro Avelino Maia de Andrade, Armando Cavalcante Franco Dias, Simone Raposo Cotta, Diogo Paes da Costa, João Tiago Correia Oliveira, Lucianne Ferreira Paes de Oliveira, Fernando José Freire, Fernando Dini Andreote and Julia Kuklinsky-Sobral

July 2018

African Journal of Agricultural Research
Climbing beans in Uganda: A perspective of smallholder farmers on their determinants, associated challenges and implications for research

In many parts of the world including Uganda climbing beans are mostly grown in highland areas where population density is high and land is limiting. The objective of this study was to contribute to understanding the current status of the factors affecting productivity of climbing beans among smallholder farmers in Uganda. Kisoro and Kabale districts in the South West were selected for the study. Primary data was...

Author(s): Rose Takusewanya, Annet Namayanja, Michael Adrogu Ugen, Stanley Nkalubo,Thomas Lapaka Odong and Godfrey Vianney Bwogi  

July 2018

African Journal of Agricultural Research
Agriculture and food security under threat of change climate in Benin

Vulnerability of agriculture to climate change has been a key issue due to its negative effect on human survival. This study aims to determine the effect of climate change on the production of crops to draw the attention of plant breeders on the paramount necessity to breed new varieties that are tolerant to abiotic stress (drought, temperature, salinity and flooding) for the happiness of farmers. Data on the...

Author(s): Vincent Ezin, Ibouraïma Yabi, Emeric G. M. Kochoni and Adam Ahanchédé  

July 2018

African Journal of Agricultural Research
Assessment of soil characteristics under four cropping and land management systems in south west Nigeria

Soil degradation and desertification pose a major threat to agricultural production in sub-Saharan Africa. The influence of cropping systems which had been established on selected physical and chemical properties of soil were investigated in Akinyode-Okinni community in Egbedore Local Government Area (LGA) of Osun State, Nigeria. The cropping systems included agri-silviculture (SCM), silvi-pasture (SPC),...

Author(s): Wasiu Agunbiade Lamidi, Onyegbula Chike Nwoke and Kabiru Alani Shittu  

July 2018

African Journal of Biotechnology
Phytochemical profile and biological activities of Momordica charantia L. (Cucurbitaceae): A review

This study discusses the bioactive composition, supercritical fluid extraction and biological activities of Momordica charantia L. from the last five years. Numerous compounds that have been identified in the extracts of M. charantia, including phytosterols, terpenoids, fatty acids, phenolic compounds, phenolic acids and flavonoids were also discussed. Although, several studies reported the use of organic solvents in...

Author(s): Mozaniel Santana de Oliveira, Wanessa Almeida da Costa, Fernanda Wariss Figueiredo Bezerra, Marilena Emmi Araújo, Gracialda Costa Ferreira and Raul Nunes de Carvalho Junior,

July 2018

African Journal of Biotechnology
Enhancement of somaclonal variations and genetic diversity using graphite nanoparticles (GtNPs) in sweet potato plants

To assay the efficiency of graphite nanoparticles (GtNPs) in sterilizing tissues and their role in enhancing genetic diversity, sweet potato is considered an important crop; hence its explants were used. In this experiment, GtNPs of 200, 400 and 800 ppm concentrations were used for sterilization of MS callus induction and regeneration media in Abees cultivar. The results showed that GtNPs had a good potential for...

Author(s): Aziza A. Aboulila, Ola A. Galal and M. F. M. El-Samahy

July 2018

African Journal of Biotechnology
Comparative evaluation of the physicochemical and pasting properties of flour from three varieties of Brachystegia spp.

The chemical compositions, functional and pasting properties of flour from three varieties of Brachystegia spp. (Brachystegia eurycoma, Brachystegia nigerica and Brachystegia kennedy) were studied. Results show that the chemical compositions of flour samples ranged from12.31 to 12.67% (protein), 1.66 to 1.72% (crude fiber), 2.06 to 2.39% (ash), 7.18 to 8.45% (fat), 3.85 to 4.75% (sugar) and 58.45 to 59.62% (starch)....

Author(s): Okorie, P. A. and Ikegwu, O. J.

July 2018

African Journal of Biotechnology
Molecular diagnosis of phytoplasma transmission from zygotic embryos to in vitro regenerated plants of coconut palm (Cocos nucifera L.)

The aim of this study was to investigate the transmission of the lethal yellowing disease (LYD) of coconut tree caused by a phytoplasma from the zygotic embryo to the regenerated plantlet in vitro. From a total of 30 trees, 150 mature coconut nuts where harvested. These nuts were used to extract 150 zygotic embryos. From this package, 96 zygotic embryos were used to regenerate 96 young coconut seedlings in vitro and the...

Author(s): DARAMCOUM Wentoin Alimata Marie Pierre, KONAN Konan Jean-Louis, YAO Saraka Didier Martial, YAIMA Arocha Rosete, KOFFI Eric-Blanchard Zadjéhi, YOBOUE Koffi, KOUASSI Kan Modeste, KOUADJO Claude Ghislaine, KOFFI Edmond, KOFFI Kouadio Kan Ghislain and N’GUETTA Assanvo Simon-Pierre

July 2018

African Journal of Biotechnology
Antimicrobial activity of metabolites extracted from Zanthoxylum gilletii, Markhamia lutea and their endophytic fungi against common bean bacterial pathogens

Antibacterial activity of extracts of Zanthoxylum gilletii, Markhamia lutea and their fungal endophytes were evaluated against bacterial pathogens of common bean: Xanthomonus axonopodis pv. phaseoli and Pseudomonus syringae pv. phaseolicola. The leaves of both plants were dried under shade, ground to fine powder and extracted using methanol. The methanol extracts were fractionated sequentially using ethylacetate and...

Author(s): Lucy Aketch Wanga, Isabel Nyokabi Wagara, Ramadhan Mwakubambanya and Josphat Clement Matasyoh

June 2018

Journal of Plant Breeding and Crop Science
Inheritance and combining ability study on drought tolerance and grain yield among early maturing inbred lines of maize (Zea mays L.)

Utilization of stress tolerant maize is key to sustainable production and food security. Limited knowledge on genetics of drought tolerance hampers development of drought tolerant varieties. The aim of this study was to study inheritance and combining ability of drought tolerance and grain yield among early inbred lines of maize. Five inbred lines were mated in full diallel in 2015 major season. The resultant 20...

Author(s): Issa Z. M. M., Nyadanu D., Richard A., Sangare A. R., Adejumobi I. I. and Ibrahim D.

June 2018

Journal of Plant Breeding and Crop Science
Development of two high-yielding, consumer-acceptable apple banana hybrids (Musa species, AAB genome group) with resistance to Fusarium oxysporum f. sp. cubense race 1

Fusarium wilt of bananas (Musa species) is caused by Fusarium oxysporum f. sp. cubense (Foc). Foc race 1 in particular affects dessert bananas in Uganda, causing >60% yield loss. This study was conducted to assess the performance of two new apple banana genotypes for bunch yield, resistance to Foc race 1 and consumer acceptability. The new apple banana genotypes (NAMU1 and NAMU2), along with two check cultivars, one...

Author(s): Henry Buregyeya,, Robooni Tumuhimbise, Jerome Kubiriba, David Talengera, Kephas Nowankunda, Geofrey Arinaitwe, Wilberforce K. Tushemereirwe, Deborah Karamura, Eldad Karamura and Patrick Rubaihayo

June 2018

Journal of Plant Breeding and Crop Science
Effect of heat stress on common bean under natural growing conditions in three locations in different climate zones in the state of São Paulo, Brazil

Common bean (Phaseolus vulgaris L.) originated in medium to high altitude regions and is sensitive to high temperatures. Climate changes from an increase in global temperatures are foreseen, and therefore better understanding of the mechanisms of heat tolerance is necessary. In this context, the aim of this study was to investigate the effects of heat stress on twelve common bean genotypes under natural growing...

Author(s): Daiana Alves da Silva, Raquel Luiza de Moura dos Reis, João Guilherme Ribeiro Gonçalves, Sérgio Augusto Morais Carbonell and Alisson Fernando Chiorato

June 2018

Journal of Plant Breeding and Crop Science
Genetic variation of tef [Eragrostis tef (Zucc.) Trotter] genotypes for reaction to tef shoot fly [Atherigona hyalinipennis Van Emden], at Maysiye, Northern Ethiopia

One of the major biotic stresses that limits tef yield is insect pests attack. Of these tef, shoot fly is sporadically important insect pest in various tef growing areas of Ethiopia. Evaluation of diversity of tef germplasm in Ethiopia for the reaction tef shoot fly might give a chance to get host plant resistance. The main objective of this study was to assess the genetic variation among tef genotypes for their...

Author(s): Chekole Nigus

June 2018

International Journal of Livestock Production
Success drivers of pig artificial insemination based on imported fresh semen

This study was conducted to assess the factors that affect pig litter size, proportion of live pigs at birth, number of inseminations per conception, and efficiency of artificial insemination. The main factors assessed were sow breed (n = 2), sire breed (n = 3), sow parity (n = 7) and insemination method (n = 2). The sow breeds used were Landrace, LL (n = 27) and Landrace × Pietran crossbreds, LP (n = 37); boar...

Author(s): Vincent Niyiragira, Kugonza Donald Rugira, and Hirwa Claire D’Andre

June 2018

International Journal of Livestock Production
Relationships between sperm morphology and semen cation concentrations in red sokoto goats (Capra aegagrus hircus)

The study evaluated the relationships between sperm morphology and semen cation concentrations in Red Sokoto bucks. A total of 31 Red Sokoto bucks were used for the study. Semen samples were collected from each animal on weekly basis for 52 weeks using an electro-ejaculator. Sperm morphological traits: detached mid-piece and tail (DMT), detached head (DH), mid-piece droplet (MPD), coiled and bent tail (CBT), and...

Author(s): Ambali A. L., Anoh K. U., and Suleiman I. O.

Page 5 of 1131, showing 50 records out of 56523 total, starting on record 201, ending on 250