African Journal of Microbiology Research
Subscribe to AJMR
Full Name*
Email Address*

Article Number - 47A422113505


Vol.6(6), pp. 1165-1170 , February 2012
DOI: 10.5897/AJMR11.1333
ISSN: 1996-0808



Full Length Research Paper

Characterization of Xanthomonas citri subsp. malvacearum strains in Iran


Ali Razaghi1, Nader Hasanzadeh2* and Abolghasem Ghasemi3




1University of Gothenburg, Göteborg, Sweden.

2Department of Plant Pathology, Science and Research Branch, Islamic Azad University, Tehran, Iran.

3Department of Plant Pathology, Iranian Research Institute of Plant Protection, Tehran, Iran.


Email: hasanzadehr@yahoo.com






 Accepted: 26 January 2012  Published: 16 February 2012

Copyright © 2012 Author(s) retain the copyright of this article.
This article is published under the terms of the Creative Commons Attribution License 4.0


Xanthomonas citri subsp. malvacearum (Xcm), the bacterial blight of cotton is the most important bacterial disease on cotton which infects all aerial parts of the host. Loss due to this disease was estimated for about 10 to 30% on Iranian native cultivars. During summer season, cotton leaves samples with typical bacterial blight symptoms were collected from cotton fields of Golestan province in 2004. Among different bacterial isolates, five distinct Xcm isolates were collected for further studies. Besides, 20 partially characterized Xcm strains were obtained from Iranian Plant Protection Organization for comparison purpose. Totally 25 strains were subcultured for further characterization based on morphological, biochemical, pathogenicity traits as well as genetic analyses. Among these, nine strains with distinct phenotypic characteristics were selected for complementary genetic studies. Sodium dodecyl sulphate - polyacrylamide gel electrophoresis (SDS-PAGE) protein analysis did not show any differences among strains in number and size of protein bands. In plasmid analysis, using alkaline lysis method, a single plasmid was detected for all examined isolates with molecular weight of 23 kb. Repetitive sequence based PCR (rep-PCR) fingerprinting assay using primer BOX AIR (5' CTACGGCAAGGCGACGCTGAC 3') also failed to differentiate the Iranian isolates. It was therefore concluded the strains might have the same origin.

 

Key words: Cotton bacterial blight, protein analysis, plasmid and repetitive sequence based PCR (rep-PCR).


APA (2012). Characterization of Xanthomonas citri subsp. malvacearum strains in Iran. African Journal of Microbiology Research, 6(6), 1165-1170.
Chicago Ali Razaghi, Nader Hasanzadeh and Abolghasem Ghasemi. "Characterization of Xanthomonas citri subsp. malvacearum strains in Iran." African Journal of Microbiology Research 6, no. 6 (2012): 1165-1170.
MLA Ali Razaghi, Nader Hasanzadeh and Abolghasem Ghasemi. "Characterization of Xanthomonas citri subsp. malvacearum strains in Iran." African Journal of Microbiology Research 6.6 (2012): 1165-1170.
   
DOI 10.5897/AJMR11.1333
URL http://academicjournals.org/journal/AJMR/article-abstract/47A422113505

Subscription Form