Sero-prevalence of hepatitis E virus (HEV) genotype 3 in goats from Sokoto Metropolis, Nigeria
September 2018
Hepatitis E virus (HEV) is a cause for public health concern in many developing countries where sanitation conditions are poor. Increasing attention has been focused on the zoonotic nature of HEV. Goats, along with other species of small ruminants have been reported to be susceptible to HEV infection. This study was designed to determine the infection rate of HEV3 by detecting antibodies against capsid proteins of HEV...
Detection of β-tubulin gene from benomyl sensitive isolates of Colletotrichum gloeosporioides causing anthracnose disease in mango
September 2018
Twenty six isolates of Colletotrichum gloeosporioides from anthracnose infected mango fruits were isolated from different places of Tamil Nadu, India and these isolates were identified as C. gloeosporioides by Internal transcribed spacer (ITS) and species specific (CgInt) primers. The sensitivity of C. gloeosporioides isolates to benomyl fungicide were evaluated at five different concentrations viz., 0.5, 1, 2, 5, 10...
Molecular phylogeny and genetic diversity studies of some potent endophytic fungi isolated from medicinal plants (Calotropis procera and Catharanthus roseus) using 18S rRNA and RAPD analysis
September 2018
Molecular identification of four endophytic fungi (Penicillium singorense, Curvularia geniculata, Aspergillus neoflavipes and Alternaria alternata) from two important medicinal plants, Calotropis procera (L.) R.Br. and Catharanthus roseus (L.) G.Don. was carried out by 18SrRNA sequencing. Genetic diversity using two RAPD primer viz. OPB-07 and OPC-06 showed good result with high polymorphism between the four strains....
Isolation and characterization of starch degrading rhizobacteria from soil of Jimma University Main Campus, Ethiopia
August 2018
Starch degrading bacteria are important for different industries such as food, fermentation, textile, and paper. The aim of this study is to isolate and characterize bacteria able to degrade starch from the rhizospheres of various plants at four sites located in Jimma University main campus. Collected soil samples were labeled as kobo (AJUMC), Avocado (BJUMC), Banana (CJUMC), and Cana indica (DJUMC) respectively. Soil...
Assessment of dominant bacterial strains isolated from Ntoba mbodi, an indigenous African alkaline-fermented food, and their potential enzyme activities
August 2018
Ntoba mbodi is a stable and long-life alkaline-fermented food and the domestic-scale production depends upon microorganisms from the local environment. Previous studies on bacteria in Ntoba mbodi have reported the presence of Bacillus related species and other bacterial taxa. But the abundance of these bacteria in Ntoba mbodi still needs to be determined to assess their ecological importance in this particular...
Screening of human diarrhoeal samples in Mymensingh city of Bangladesh for the isolation, identification and antimicrobial resistance profiles of Campylobacter spp.
August 2018
Campylobacter spp. (Campylobacter jejuni and Campylobacter coli) are one of the major cause of food-borne bacterial diarrhoea in human worldwide. This study was conducted for the isolation, identification and antimicrobial resistance profiling of Campylobacter spp. from diarrhoeal samples of human collected from Surya Kanta (SK) hospital, Mymensingh Medical College, Mymensingh during the period of August 2016 to October...
Molecular detection and characterization of Escherichia coli, Salmonella spp. and Campylobacter spp. isolated from broiler meat in Jamalpur, Tangail, Netrokona and Kishoreganj districts of Bangladesh
August 2018
The study was conducted to isolate, identify and characterize bacterial samples from broiler meat collected from 20 different upazilla markets of Jamalpur, Tangail, Netrokona and Kishoreganj districts of Bangladesh. A total of 20 samples were subjected to bacteriological isolation and identification, and the isolated bacteria were subjected to antimicrobial susceptibility testing using disc diffusion method. Among the...
Isolation and identification of Escherichia coli, Salmonella and Pasteurella from holding grounds of live-bird markets at Addis Ababa, Ethiopia
August 2018
A cross-sectional study was conducted to isolate and identify of Escherchia coli, Pastuerella multocida, Salmonella gallinarum and Salmonella pullorum from the holding grounds of five purposively selected Addis Ababa live bird markets from November 2016 to May 2017 using bacterial culture, grams staining and biochemical testing. A total of 90 pooled fecal samples were collected as both deep (35) (bottom layer of the...
Antimicrobial susceptibility pattern of Gram negative bacteria isolated from intensive care units in Al-Ahsa, Kingdom of Saudi Arabia
August 2018
Antimicrobial resistance by bacteria isolates continues to receive attention globally. This investigation looks into the antibiotic susceptibility pattern of Gram negative bacteria isolated from intensive care unit patients in Al-Ahsa, KSA. Bacteria samples were classified based on the CDC criteria for the definition of ICU infections. Gram negative bacteria had been isolated on MacConkey agar using basic...
Efficacy of plasma micro broth dilution assay for antifungal susceptibility testing of Candida albicans
August 2018
Fungal infection and antifungal drug resistance especially in the treatment of immuno suppressive syndromes, has created an increased demand for reliable and affordable methods of in vitro testing of antifungal agents that can assist in their diagnosis. This study aimed to investigate antifungal susceptibility testing method that is reliable, flexible, affordable, accurate, cheap and less time consuming in order to...
Low accuracy of the McFarland method for estimation of bacterial populations
August 2018
The McFarland method is designed to estimate bacterial concentrations by means of a turbidity scale (absorbance) which consists of a series of tubes previously calibrated, and with an optical density produced by the precipitation of barium sulphate. This absorbance is compared to bacterial populations. The most used absorbance is the one corresponding to 0.5 on that scale, which assumes a population of 1.5×108...
Prevalence and genetic diversity of the strains of Bacillus cereus groups in food for infants and young children in México
August 2018
The aim of this study was to determine the prevalence and genetic diversity of the strains of Bacillus cereus groups isolated in México from foods for infants and young children. A total of 94 foods from a single commercial brand were analyzed to find B. cereus through a pre-enrichment method of colonial morphology in agar mannitol yolk polymyxin. Specific colonies were selected to be analyzed by polymerase chain...
Antimicrobial resistance pattern of Acinetobacter spp. isolated from clinical samples in a tertiary care hospital at Madinah, Saudi Arabia
August 2018
Multidrug resistance, in rapidly spreading bacterial species, is a matter of concern in health care units. Samples (6840) collected from a Saudi hospital in Madinah, were screened for Acinetobacter spp. and studied for frequency, gender distribution, and seasonal variations besides antimicrobial resistance pattern. Acinetobacter strains represented 5.5% of the clinical isolates from different sources. Of these, 63% were...
Internal transcribed spacers (ITS) based identification of Trichoderma isolates and biocontrol activity against Macrophomina phaseolina, Aspergillus niger and Meloidogyne incognita
August 2018
Ten Trichoderma isolates were isolated from different locations in Egypt. Amplification and sequencing of internal transcribed spacers (ITS) was employed to identify Trichoderma isolates that exhibited from 99 to 100% identity with three species of Trichoderma: Trichoderma harzianum, Trichoderma asperellum and Trichoderma longibrachiatum. The biocontrol activity of Trichoderma isolates against Macrophomina phaseolina,...
Isolation of a Lactobacillus strain from aguamiel and preliminary characterization of its antimicrobial components
August 2018
The aim of the study was to characterize the antimicrobial components of Lactobacillus paracasei KSI. In the study, a L. paracasei KSI strain was isolated and identified from aguamiel using a 16S rRNA, hsp, recA and rpoBgenes sequencing. The antimicrobial capacity of the L. paracasei strain KSI was determined by agar double layer diffusion technique, while the antagonistic activity of the cell-free extract (E-KSI)...
Identification of endophytic fungi from roots of two Dendrobium species and evaluation of their antibacterial property
August 2018
Among all orchids, Dendrobium sp. is considered to have high medicinal value. Dendrobium moniliforme and Dendrobium transparens have immense pharmaceutical, commercial potentiality. However, their fungal endophytes remain unexplored. Isolation and identification of thirteen species of endophytic fungi from the root of D. moniliforme as well as five species from the roots of D. transparens were done. The two endophytic...
Quality of water for human consumption in a rural area community from Brazil
August 2018
This work aimed at evaluating the bacteriological, parasitological, physical and chemical quality of water intended for human consumption in a community in a rural area of Recôncavo of Bahia (Brazil) and the factors related to a possible contamination. Samples were collected at two different times: at rainy season (August to September, 2015) and dry season (April 2016). The present work evaluated the presence of...
Using light emitting diodes at 450 nm for in vitro treatment of water intended for human consumption
August 2018
This study aimed to evaluate the in vitro antimicrobial effect of exposing raw water intended for human consumption to light (λ= 450 nm) and to investigate the correlation between the results obtained and physical and chemical parameters. Fifteen (15) samples of raw water were collected from households in a rural area of ​​Santo Antônio de Jesus – Bahia (Brazil), from November to December 2016. A...
Antimicrobial resistance patterns of Enterobacteriaceae recovered from wastewater, sludge and dumpsite environments in Kakamega town, Kenya
July 2018
Enteric bacterial resistance to antibiotics and the emergence of resistant pathogens in the environment is a global threat to public health. In Kenya, sewage treatment plants are not designed to eliminate enteric microbes, whereas domestic, medical and other hazardous wastes are all discarded in common solid-waste dump sites. Arising from these practices, waste treatment sites in developing countries may be important...
Biofertilising, plant-stimulating and biocontrol potentials of maize plant growth promoting rhizobacteria isolated in central and northern Benin
July 2018
Plants constantly interact with a multitude of microorganisms that they select among other things through their roots. Some bacteria, known as plant growth promoting rhizobacteria (PGPR), are able to stimulate growth and control plant diseases, thanks to the expression of a wide range of beneficial properties to the plant. The aim of this work was to search for biofertilizing, plant-stimulating and biocontrol potentials...
Identification and molecular phylogeny analysis using random amplification of polymorphic DNA (RAPD) and 16SrRNA sequencing of N2 fixing tea field soil bacteria from North Bengal tea gardens
July 2018
Random amplification of polymorphic DNA (RAPD) amplification genomic DNA of 23 selected laboratory cultures of bacteria using RAPD revealed their polymorphism. Polymerase chain reaction (PCR) amplification of the bacterial 16SrDNA was performed using 704F GTAGCGGTGAAATGCGTAGA and 907R CCGTCAATTCCTTTGAGTTT primer, sequenced and accessed in NCBI (No. KY636356, KY631488, KY 860028, KX587470, KX665547, KY631489, KX608591,...
Paediatric tuberculosis in a low burden setting of Saudi Arabia: Drug and multidrug resistance patterns
July 2018
In this study, the infection of young children with Mycobacterium tuberculosis and drug-resistant M. tuberculosis in a mass gathering area in Al-Madinah Al-Munawwarah, was investigated and discussed. All the children, 15 years old and younger, who were referred to the central tuberculosis laboratory in Al-Madinah between January 2012 and December 2014 were included in this study. Among a total of 622 registered new...
Study on prevalence and genetic discrimination of methicillin-resistant Staphylococcus aureus (MRSA) in Egyptian hospitals
July 2018
Methicillin-resistant Staphylococcus aureus (MRSA) continues to be a global problem in infection control. The highest proportions of MRSA are reported by Jordan, Egypt and Cyprus investigators, where more than 50% of the invasive isolates are methicillin-resistant. The aim of this work was to study the prevalence, antibiotic sensitivity and genetic discrimination of MRSA in Egypt. Microbiological identification was done...
Microbiological quality of fruit juices sold in cafes and restaurants of Shewarobit town, Amhara, Ethiopia
July 2018
Fresh and unpasteurized fruit juice is common in restaurants, cafeteria, hotels and juice house of Ethiopian cities. Most fruit juices contain sufficient nutrients that could support microbial growth. The current investigation was carried out to investigate the microbiological quality and processing conditions of fruit juice vended in Shewarobit town. Purposive sampling technique was employed to collect sixteen fruit...
Isolation of bacterial diversity present in medical waste and health care settings in hospitals in Kenya
July 2018
Nosocomial infections have impacted great burden in healthcare system and has led to deteriorating health condition and deaths. This study characterizes medically important bacterial diversity, isolated from staff hands, hospital surfaces and wastes in healthcare settings in Kenya during a one year period. Descriptive cross sectional hospital based study design and simple random sampling method was used to collect 246...
Fungal endophytes isolated from the leaves of a medicinal plant, Ocimum sanctum Linn and evaluation of their antimicrobial activities
July 2018
The endophytic fungi isolated from leaves of Ocimum sanctum Linn. of different ages were examined for antimicrobial activity. The agar plug diffusion assay was used for primary screening. A total of 148 fungal endophytes were successfully isolated and cultured but only 134 of them (90.5%) exhibited inhibitory activity towards at least one test microorganisms. Moreover, the colonization rate indicated that the old leaves...
Differential niche occupation and the biotechnological potential of Methylobacterium species associated with sugarcane plants
July 2018
This work highlighted a putative link between the physiological activity and genetic diversity of Methylobacterium species and the association with sugarcane roots and rhizoplane. In total, 40 isolates previously described as pink-pigmented facultative methylotrophic bacteria (PPFMs), were evaluated for their ability to fix nitrogen and solubilize inorganic phosphate, amylase and pectinase activity. This in vitro...
Microbiological quality and safety of milk production and marketing in Hawassa district, Ethiopia
July 2018
The microbiological quality and safety of milk samples from different sources in Hawassa distinct from southern nations, nationalities and people regional state was evaluated. A total of 63 raw milk samples were obtained from three selected dairy farms, urban and rural households. Twenty-seven pasteurized milk samples were obtained from three retail brands from various supermarkets in Hawassa city. Each milk...
Determination of aflatoxin M1 in bovine milk from the Alagoas/Brazil State dairy belt by high performance liquid chromatography (HPLC)
July 2018
Milk is considered a nutritionally noble food and is therefore suitable for feeding children and adults. However, contamination of milk by mycotoxins may pose a health risk to the consumer. Aflatoxins, mycotoxins produced by fungi of the genus Aspergillus, can be found in several food products, including milk and its derivatives, which reinforces the importance of this type of study on the occurrence of the aflatoxin M1...
Phylogenetic diversity of prokaryotes on the snow-cover of Lewis glacier in Mount Kenya
June 2018
The seasonal snowpack of the temperate glaciers are sources of diverse microbial inoculi. However, the microbial ecology of the tropical glacial surfaces is endangered, hence poses an extinction threat to some populations of some microbes due to rapid loss of the glacier mass. The aim of this study was to isolate and phylogenetically characterise the prokaryotes from the seasonal snow of Lewis glacier in Mt. Kenya. Snow...
Bacteriological quality of drinking water obtained from main sources, reservoirs and consumers’ tap in Arba Minch town, Southern Ethiopia
June 2018
The most common and wide spread health risk associated with drinking water is microbial contamination. The aim of this study is to assess microbial contamination of drinking water, starting from source to distribution systems. Water samples from the Arba Minch town of Southern Ethiopia were collected randomly from the main source before chlorination, reservoir after chlorination and from different points of distribution...
Isolation and characterization of thermophilic bacteria from different habitats and their assessment for antagonism against soil-borne fungal plant pathogens
June 2018
Three different biomaterials viz., boiled cow milk, compost manure and tomato rhizospheric soil were found as habitats of the thermophilic antagonistic bacteria. The isolated bacteria were able to grow satisfactorily at thermophilic temperature range (>55ï‚°C). Based on morphological, biochemical and physiological characters, the bacterial isolates were identified as Bacillus licheniformis (boiled cow milk), and...
Detection of alpha toxin and enterotoxins of Clostridium perfringens isolated from minced meat by real time polymerase chain reaction (PCR)
June 2018
Clostridium perfringens is one of the most widespread pathogen producing toxins related to variable pathogenic conditions, particularly food poisoning in humans. Thus, this study described the prevalence, enumeration, toxigenic types and antibiotic susceptibility of C. perfringens strains isolated from minced meat in Egypt as well as the validation of a real-time polymerase chain reaction (PCR) test for...
Response of microbial communities to oil spill in the Gulf of Mexico: A review
June 2018
Crude oil has become a part of the marine ecosystem through natural seeps and oil spills. Microbial communities have adopted various response mechanisms to adjust to oil spills that contaminate the marine environment and help restore the ecosystem to its original state. These response mechanisms ranges from change in indigenous microbial community composition, change in microbial diversity to gene diversity and...
Foods, fish and salmonellosis
June 2018
Foodborne diseases are those caused by the consumption of water and food contaminated by different causal agents such as: viruses, bacteria, parasites, toxins, among others, being considered an important public health problem global due to its incidence and mortality and for several years for the isolation of microorganisms that cause these diseases resistant to antimicrobials. Salmonella species is considered a food...
Thermotolerant bacteria of biotechnological potential from hot springs in Eritrea
June 2018
Thermophiles are excellent sources of enzymes that can withstand and carry out reactions efficiently under high temperatures. This study isolated and characterised thermotolerant bacteria that produce enzymes of potential industrial value from five hot springs in Eritrea. A total of 65 bacterial isolates were obtained from the five hot springs. Out of the 65 isolates; 19 isolates produced a positive reaction for...
Assessment of microbiota in root canals with pulp necrosis by means of Gram test
June 2018
The aim of this study was to evaluate the type of microbiota present in root canals with pulp necrosis, with and without periapical lesion. Nineteen patients were selected for the study and 30 root canals were analysed in unirradicular and/or multi-radicular permanent teeth, asymptomatic, with pulp necrosis, with or without periapical lesion, and no communication between root canal and oral cavity. Absorbent paper cones...
Prevalence, cytotoxicity and antibiotic susceptibility of Campylobacter species recovered from retail chicken meat in Mansoura, Egypt
June 2018
This study was performed to determine the prevalence of Campylobacter species in retail chicken meat and chicken by-product, determine their in vitro cytotoxicity, as well as, examine their susceptibility to different antimicrobials. A total of 300 raw chicken meat samples were collected from different retail chicken meat outlets located at Mansoura city, Egypt classified into 120 thighs, 120 breasts, and 60 livers. All...
Exploration of sulfate reducing bacteria from polluted waters
June 2018
Sulfate reducing bacteria (SRB) was successfully isolated from Estuary Dam in Suwung Denpasar, Indonesia. This estuary catches highly polluted water from Badung River which runs across and hence carries pollution due to waste disposal from Denpasar City. SRB was studied in detail for their ability to reduce sulfate to sulfide with organic material as an oxidizing agent. SRB exploration of the estuary ecosystem of the...
Exploratory study of hepatitis D virus infection in HBsAg carriers in Abidjan, Côte D’ivoire in 2016
June 2018
In sub-Saharan Africa, the prevalence of co-infection with hepatitis D (HDV) and hepatitis B viruses (HBV) is poorly known. Chronic infection with HBV is currently treated by nucleoside analogs whereas interferon is used to inhibit HDV. Nevertheless, Hepatitis Delta is not routinely diagnosed in Côte d’Ivoire. This study aims to estimate the current prevalence of Hepatitis D infection among HBV-infected...
Seroprevalence of canine leptospirosis, in Urban and Periurban, Morogoro, Tanzania
June 2018
A cross-sectional study was carried out in the Morogoro region, Tanzania, to determine the seroprevalence of canine Leptospira exposure. A total of 232 sera were collected from apparently healthy dogs in Mvomero, Morogoro Urban and Morogoro Rural districts. The microscopic agglutination test (MAT) was performed following standard procedure using panel of six Leptospira serovars. Within the districts, positive reactions...
Isolation and identification of Escherichia coli and Edwardsiella tarda from fish harvested for human consumption from Zeway Lake, Ethiopia
May 2018
A cross sectional study was conducted from November to June 2014/2015 in fish harvested for human consumption at Lake Zeway with the objective of isolating Edwardsiella tarda and Escherichia coli important pathogens and contaminants its products. Three hundred tissue samples comprising Spleen, Liver and Intestine were collected from 100 fish (12 Clarias gariepenus and 88 Oreochromis niloticus) originated from lake...
Antimicrobial activity of the extracts of Albizia masikororum R.Vig., a Fabaceae from Madagascar
May 2018
This study is aimed at the assessment of antimicrobial potential of Albizia masikororum, a Malagasy Fabaceae. Hexanic and methanolic extracts from fruit pods, stem bark, leaves and seeds were tested by disc diffusion and microdilution methods on 10 pathogenic microorganisms including four Gram positive bacteria, five Gram negative bacteria and one yeast. Only the leaf and seed methanolic extracts, LME and SME...
In-vitro antibiotic susceptibility profile of Salmonella enterica Serovar Typhi isolated from fecal specimens of humans in Umuahia metropolis, Abia State, Nigeria
May 2018
Typhoid is routinely diagnosed in Nigeria on clinical grounds or based on Widal serological test result. This approach does not provide information on the antibiotic susceptibility of the bacterium; Salmonella enterica Serovar Typhi. This study was done to assess the antimicrobial susceptibility profile of Salmonella isolates in Umuahia. In this study, seventy-two (72) Salmonella isolates obtained from 135 fecal...
Emphasis on functional properties of cocoa-specific acidifying lactic acid bacteria for cocoa beans fermentation improvement
May 2018
Lactic acid bacteria (LAB) strains isolated from six main Ivorian cocoa producer regions were investigated based on their biochemical properties in order to select the best one as potential starter. Three main technological and useful properties for good cocoa beans fermentation were monitored among the 568 isolated LAB strains. Thus, between the 408 cocoa-specific acidifying LAB strains identified, 05.88% (24 isolates)...
Molecular characterization of Listeria monocytogenes isolated from a ready-to-eat fermented milk and cereal product, Fura-de-Nunu
May 2018
This study was conducted to determine the occurrence of Listeria (L.) monocytogenes in Fura-de-Nunu, a ready-to-eat (RTE) fermented milk (Nunu) and cereal (Fura) blend, the serogroups as well as the virulence of the isolates. A total of 75 Fura and 75 Nunu samples were examined. Listeria species were isolated on PALCAM medium and Listeria chromogenic agar, and identified phenotypically according to International...
OXA-48 type carbapenemase in Klebsiella pneumoniae producing extended spectrum B-lactamases (ESBL) in Senegal
May 2018
Enterobactericeae producing extended spectrum b-lactamases (ESBL) are likely to express carbapenemases OXA-48 which have hydrolytic activity on carbapenems. The aim of this work was to evaluate prevalence of blaOXA-48 for Klebsiella pneumoniae isolates producing ESBL. This work was conducted at the French Reference Center for Antibiotic Resistance with strains from Senegalese Hospital. Standard antibiogram was performed...
Bactericidal and brine shrimps toxicity of essential oils from Aframomum Melegueta [K. Schum]
May 2018
Aframomum melegueta (Roscoe) K. Schum, family of Zingiberaceae, is a tropical tree with spicy edible fruit. This plant has both medicinal and nutritive values. There is paucity of literature on the toxicity and bioactivity of the essential oils from this plant from Nigeria. Essential oils were extracted from the leaves, stems, roots (rhizomes) and seeds of the plant through hydro-distillation using the Clevenger-type...
Effect of processing methods on the chemical composition and microbiological quality of vegetable drink extract of african bush mango (Irvingia gabonensis)
May 2018
The effect of processing methods on the chemical composition, proximate, mineral, vitamin and microbiological quality of vegetable drink extract of Irvingia gabonensis was studied. The processing methods included drying (shade and solar drying), blanching (at 0, 2, 4 and 6 min) as well as blanching and drying of the leaves. Aqueous extracts were obtained from the leaves and the analysis carried out using standard...
Antibacterial activity of selected Dendrobium species against clinically isolated multiple drug resistant bacteria
May 2018
Dendrobium species are widely used in traditional medicine as remedies for tonic to nourish the stomach, promote the production of body fluids and decrease fever. In this study, the antibacterial activities of four traditionally used Dendrobium species were tested against clinically isolated multiple drug resistant (MDR) bacteria. Hexane, chloroform, acetone, ethanol and methanol extracts of Dendrobium amoenum,...
Page 7 of 104, showing 50 records out of 5173 total, starting on record 301, ending on 350
Advertisement
Advertisement