African Journal of
Agricultural Research

  • Abbreviation: Afr. J. Agric. Res.
  • Language: English
  • ISSN: 1991-637X
  • DOI: 10.5897/AJAR
  • Start Year: 2006
  • Published Articles: 6590

Short Communication

First report in Southern Brazil of Alternaria alternata causing Alternaria leaf spot in alfalfa (Medicago sativa)

Mariana Rockenbach de Avila*
  • Mariana Rockenbach de Avila*
  • Department of Forage Plants and Agrometeorology, Federal University of Rio Grande do Sul, Porto Alegre, Brazil.
  • Google Scholar
Miguel Dall Agnol
  • Miguel Dall Agnol
  • Department of Forage Plants and Agrometeorology, Federal University of Rio Grande do Sul, Porto Alegre, Brazil.
  • Google Scholar
Érika Sayuri Maneti Koshikumo
  • Érika Sayuri Maneti Koshikumo
  • Department of Plant Pathology, Federal University of Rio Grande do Sul, Porto Alegre, Brazil.
  • Google Scholar
Jose Antonio Martinelli
  • Jose Antonio Martinelli
  • Department of Plant Pathology, Federal University of Rio Grande do Sul, Porto Alegre, Brazil.
  • Google Scholar
Gerarda Beatriz Pinto da Silva
  • Gerarda Beatriz Pinto da Silva
  • Department of Plant Pathology, Federal University of Rio Grande do Sul, Porto Alegre, Brazil.
  • Google Scholar
Raquel Schneider-Canny
  • Raquel Schneider-Canny
  • Department of Forage Plants and Agrometeorology, Federal University of Rio Grande do Sul, Porto Alegre, Brazil.
  • Google Scholar
Jose Antonio R. Souza*
  • Jose Antonio R. Souza*
  • Instituto Federal Goiano ? Câmpus Urutaí, Urutaí ? GO, Brazil.
  • Google Scholar
Debora A. Moreira
  • Debora A. Moreira
  • Instituto Federal Goiano ? Câmpus Urutaí, Urutaí ? GO, Brazil.
  • Google Scholar
Naiara M. Conde
  • Naiara M. Conde
  • Instituto Federal Goiano ? Câmpus Urutaí, Urutaí ? GO, Brazil.
  • Google Scholar
Wanderbeth B. Carvalho
  • Wanderbeth B. Carvalho
  • Instituto Federal Goiano ? Câmpus Urutaí, Urutaí ? GO, Brazil.
  • Google Scholar
Aluizio A. Fernandes
  • Aluizio A. Fernandes
  • Instituto Federal Goiano ? Câmpus Urutaí, Urutaí ? GO, Brazil.
  • Google Scholar


  •  Received: 06 October 2014
  •  Accepted: 22 January 2015
  •  Published: 05 February 2015

 ABSTRACT

Alfafa plants with symptoms of Alternaria leaf spot from the Atlantic forest biome and Pampa biome, Brazil, were collected to identify the pathogen associated in this disease. The pathogen was isolated, analyzed morphologically according to literature and later molecularly identified. After that, pathogenicity tests were conducted in a greenhouse to confirm the Koch’s postulates. The first symptoms occurred after five days of inoculation. Initially the symptoms were dark formations becoming rounded blotches about 1 mm to 3 mm in diameter that appeared on both edges and in the center of the leaflets. From this data, we concluded that this is the first report of Alternaria alternata in Brazil.

 

Key words: Forage legumes, fungal disease, inoculation, pathogenicity.

 


 INTRODUCTION

Alfalfa stands out from other forage legumes species in terms of its nutritive value, but it is susceptible to attack from more than 70 different pathogens (Thal and Campbell, 1987). In Brazil, there are few studies and only thirteen fungal diseases have been detected (Iamauti and Massola, 2005). When alfalfa plants are attacked by foliar pathogens, losses in quality of hay, reduction in green forage production and limitations on the development of plants occur. Information about diseases occurring in alfalfa in Brazil is restricted and because of the growing interest in this species, it is essential to do more research to better understand these diseases.  To  our  knowledge, this is the first report in Southern Brazil of Alternaria alternata causing Alternaria leaf spot (ALF) in alfalfa. These contributions are very important for breeding and selection of productive cultivars that are resistant to pathogens


 MATERIALS AND METHODS

Sampling
 
Symptoms of ALF were observed in Medicago sativa cv. Crioula plants in the highland (Atlantic forest  biome)  and  lowland  (Pampa  biome) regions of Rio Grande do Sul State, Southern Brazil. The symptomatic leaves were collected from six agro-ecological farms located in the highland region and from Embrapa Pecuária Sul, a research institution using conventional tillage in the lowland region. Samples were collected in winter (July and August) and spring (October) of 2013; these are periods of high relative humidity.
 
Morphological characterization and molecular identification
 
All isolates were identified as being A. alternata based on morphological analysis using literature with a descriptive key (Barnett and Hunter, 1987).  This identification was confirmed by the Biological Institute of São Paulo for the isolates from both regions. The isolated DNA was extracted according to the method described by Doyle and Doyle (1987) from the mycelium produced in Potato Dextrose Agar (PDA). The extracted genomic DNA samples were subjected to Polymerase Chain Reaction (PCR) for amplification of the ITS (internal transcribed spacer) rDNA region and part of the RPB2 gene (encoding the second largest subunit of RNA polymerase II). The primers for the ITS region were ITS1 (5’ –TCCGTAGGTGAACCTGCGG – 3’) and ITS4 (5’ – TCCTCCGCTTATTGATATGC – 3’) (White et al., 1990) and for gene segment rpb2 were RPB2-5F2 (5’ – GGGGWGAYCAGAAGAAGGC – 3’) (Sung et al., 2007) and fRPB2-7cR (5’ – CCCATRGCTTGYTTRCCCAT – 3’) (Liu et al., 1999). Samples of the two isolates were deposited in the fungal collection of the Biological Institute of São Paulo in June 2014 (register number: MMBF 12/14).
 
Fungus isolation and Koch’s postulates
 
The fungus was isolated from necrotic leaf tissue, grown in PDA and incubated at 25°C for 10 days. Pathogenicity was confirmed based on Koch’s postulates using twelve plants from five different cultivars and genotypes (CUF 101, Crioula, ABT 805, E1C4 and Chile). Eight weeks after emergence alfalfa plants were grown in pots containing autoclaved soil. The plants were inoculated with spore suspension (106 conidia/ml). The spore suspension of A. alternata was prepared by brushing plates containing PDA medium colonized by the pathogen for ten days into distilled water. The concentration of the suspension was determined using a Neubauer chamber. Inoculation was conducted in the greenhouse and plant growth chamber with two repetitions using two types of isolates (highland and lowland).  Measurements of length and width of spores (800 for each isolate: highland and lowland) of Alternaria alternata were conducted on the stereoscopic microscope Leica MZ-12, with a graduated ocular lens under 80 times magnification.


 RESULTS AND DISCUSSION

In 80% of the plants collected, the symptoms occurred in the lower leaves, probably due to higher humidity.  Plants with symptomatic leaves died faster than healthy plants and there was senescence only in injured plants. Symptoms began 5 days after inoculation and developed in all inoculated plants with a subsequent increase in the frequency and size of lesions. Leaf symptoms were initially dark formations becoming rounded blotches about 1 mm to 3 mm in diameter that appeared on both edges and in the center of the leaflets (Figure 1). 
 
 
Symptomatic plants showed reduced vigor, premature senescence and foliar chlorosis.  The initial lesions were small, circular to oval, sunken and medium brown, but later became necrotic and dark brown as the disease progressed, showing concentric zones encircled with a chlorotic halo. Intense dark sporulation was observed on the lesions. Long chains of pale to light brown clavate conidia were observed with up to three longitudinal septa, and one to seven transverse septa which varied in size according to the source of the isolates; with the highland isolates being 5 x 13.7 µm (mean 28 µm) by 5 x 37.5 µm (mean 23.6µm) and the lowland isolates 5 x 11.5 µm (mean 22.5 µm) by 7.5 x 18.8 µm (mean 32 µm). Conidiophores were elongated, straight, septate, and light to olive golden brown with a conidial scar (Figure 2).
 
 
In molecular identification, the sequenced region showed 99% similarity with a reference sequence for A. alternata. The RPB2 sequences isolated are 100% identical A. alternata (GenBank JQ811952 and JQ911953). These sequences of   A. alternate   were   submitted   to mycologist Dr. Barry Pryor, University of Arizona, (Pryor and Gilbertson, 2000).

 


 CONFLICT OF INTEREST

The authors have not declared any conflict of interest.


 ACKNOWLEDGMENT

The authors acknowledge Coordenação de Aperfeiçoamento de Nível Superior (CAPES) and Embrapa Pecuária Sul for funding this research.



 REFERENCES

Barnett HC, Hunter BB (1987). Illustrated genera of imperfect fungi. 3rd ed. Minneapolis: Burgess Publ. P. 218.
 
Doyle JJ, Doyle JL (1987) A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 19:11-15.
 
Iamauti MT, Salgado CL (1997). Diseases of alfalfa. Manual of plant pathology: diseases of cultivated plants. 3.ed. São Paulo: Agron. Ceres 2:26-32.
 
Liu YJ, Whelen S, Hall BD (1999). Phylogenetic relationships among ascomycetes: Evidence from an RNA polymerse II subunit. Mol. Biol. Evol. 16:1799–1808.
CrossRef
 
Pryor BM, Gilbertson RL (2000). Molecular phylogenetic relationships amongst Alternaria species and related fungi upon analysis of nuclear ITS and my SSu rDNA sequences. Mycol. Res. 104(11):1322-1321.
CrossRef
 
Sung GH, Sung JM, Hywel-Jones NL, Spatafora JW (2007). A multi-genephylogeny of Clavicipitaceae (Ascomycota, Fungi): Identification of localizedincongruence using a combinational bootstrap approach. Mol. Phylogenet. Evol. 44:1204–1223.
CrossRef
 
Thal WM, Campbell CL (1987). Assesment of resistence to leaf diseases among alfafa cultivars in North Carolina fields. Phytopathology 77(6):964-968.
CrossRef
 
White TJ, Bruns T, Lee S, Taylor JW (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogeneticsIn: PCR Protocols: A Guide to Method s and Applications, eds. Innis, M. A., D. H. Gelfand, J. J. Sninsky, and T. J. White. Academic Press, Inc., New York. pp. 315-322.




          */?>