African Journal of
Microbiology Research

  • Abbreviation: Afr. J. Microbiol. Res.
  • Language: English
  • ISSN: 1996-0808
  • DOI: 10.5897/AJMR
  • Start Year: 2007
  • Published Articles: 5137

Full Length Research Paper

Assessing the polymorphism of DHFR gene from Plasmodium falciparum in the south of Côte d’Ivoire

Dagnogo Oléfongo
  • Dagnogo Oléfongo
  • UFR Biosciences, Felix Houphouët-Boigny University, BP V 34 Abidjan 01, Côte d'Ivoire.
  • Google Scholar
Ako Aristide Berenger
  • Ako Aristide Berenger
  • Institute Pasteur of Côte d'Ivoire, 01 BP 490 Abidjan 01, Côte d'Ivoire.
  • Google Scholar
Bla Kouakou Brice
  • Bla Kouakou Brice
  • UFR Biosciences, Felix Houphouët-Boigny University, BP V 34 Abidjan 01, Côte d'Ivoire.
  • Google Scholar
Dago Dougba Noel
  • Dago Dougba Noel
  • UFR Sciences Biologiques, Péléforo Gon Coulibaly University, BP1328 Korhogo, CoÌ‚te d’Ivoire.
  • Google Scholar
Coulibaly N'golo David
  • Coulibaly N'golo David
  • Institute Pasteur of Côte d'Ivoire, 01 BP 490 Abidjan 01, Côte d'Ivoire.
  • Google Scholar
Coulibaly Baba
  • Coulibaly Baba
  • Institute Pasteur of Côte d'Ivoire, 01 BP 490 Abidjan 01, Côte d'Ivoire.
  • Google Scholar
Touré Offianan André
  • Touré Offianan André
  • Institute Pasteur of Côte d'Ivoire, 01 BP 490 Abidjan 01, Côte d'Ivoire.
  • Google Scholar
Djaman Allico Joseph
  • Djaman Allico Joseph
  • UFR Biosciences, Felix Houphouët-Boigny University, BP V 34 Abidjan 01, Côte d'Ivoire.
  • Google Scholar


  •  Received: 24 February 2020
  •  Accepted: 31 March 2020
  •  Published: 31 May 2020

 ABSTRACT

Since 2005, Côte d'Ivoire has adopted new strategies of malaria management including free provision of Artemisinin-based Combination Therapy (ACT) to children less than five years of age and sulfadoxine-pyrimethamine (SP) as Intermittent Preventive Treatment (IPT) for pregnant women. However, introduction of ATCs raises concerns about the extensive use of cheap SP which could increase Plasmodium falciparum resistance level to SP. Therefore, this study aimed to determine the prevalence of the Asn-108 marker in three sites in Southern Côte d'Ivoire. After obtaining consent, blood samples were collected in Anonkoua-kouté, Port-Bouët, and Ayamé sites from 180 patients over 2 years of age and having simple P. falciparum malaria. P. falciparum genomic DNA extracted from these samples was amplified by nested-PCR with pfdhfr specific primers. The amplification products were revealed by electrophoresis on 1.5% agarose gel and then sequenced according to Sanger method. After sequencing, the prevalence of mutation points associated with P. falciparum resistance to pyrimethamine was determined. For the three study sites, 180 DNA fragments, of which 165 (165/180 or 91.66%) were successfully sequenced. Analysis of the 165 sequences indicated a prevalence of 61.29% (76/124) of the Asn-108 mutant allele versus 17.41% (27/155) of the wild type Ser-108 allele. Results also indicated that the prevalence of Ser-108-Asn mutation were 69.07, 69.04 and 82.75% for Anonkoua-Kouté, Port-Bouët and Ayamé, respectively. More than a decade after the adoption of SP as IPT for pregnant women, the prevalence of the marker Asn-108 was relatively high in Anonkoua-kouté, Port-bouët and Ayamé.
 
Key words: Pfdhfr, Asn-108, Côte d'Ivoire, sulfadoxine-pyrimethamine, resistance, antimalarial drug.


 INTRODUCTION

Malaria remains a major cause of morbidity worldwide. According to the World Health Organization (WHO), 219 million cases of malaria were recorded in 2017,  of  which 345,000 led to death with 93% occurrence in Africa (WHO, 2018). For children under five years of age, the deaths were estimated to 61% in 2017 (WHO, 2018).
 
 
The treatment of this disease involves antimalarial drugs, because effective vaccine is not yet available. However, malaria control is limited by Plasmodium falciparum resistance to most antimalarial drugs. Indeed, high levels of chloroquine resistance have forced some countries to abandon chloroquine as first-line treatment in favor of sulfadoxine-pyrimethamine (SP). However, resistance to this drug has emerged regarding treatment failures reported in Africa, Asia, Indonesia and South America (Adnan et al., 2018; Ratcliff et al., 2007; Ravi (2016); Shannon and Miriam (2015); Vladimir et al., 2010).
 
Pyrimethamine and sulfadoxine act synergistically to inhibit two important enzymes in the pathway of parasite folate biosynthesis namely dihydrofolate reductase (DHFR) and dihydropteroate synthetase (DHPS) (Kasturi et al., 2018; Yaro, 2009). Mutations in pfdhfr and pfdhps genes confer resistance to pyrimethamine and sulfadoxine respectively, with an in vitro decrease in P. falciparum sensitivity related to the number of mutations in each gene (Ingrid and John, 2010; Vladimir et al., 2010). These mutations are correlated with treatment failure in clinical trials (Ratcliff et al., 2007; Yaro, 2009).
 
The presence of mutations in pfdhfr gene appears to be more important in treatment failure than mutations in pfdhps gene (Sankar et al., 2010). Indeed, the triple mutation in codons 108, 51 and 59 of pfdhfr gene increases the risk of in vivo resistance to SP by 4.3 (OR; 95% CI: 3.0-6.3, meta-analysis of 16 studies) (Picot et al., 2009). Detection of Ser-108-Asn mutation is predictive of the presence of the other two mutations.
 
In Côte d'Ivoire, since 2005, SP has been used as intermittent preventive treatment (IPT) in pregnant women and children as recommended by the WHO (WHO, 2016). However, introduction of ATCs raises concerns about the extensive use of cheap (SP) which could increase P.  falciparum resistance level to SP. This study, conducted in three sites in Southern Côte d'Ivoire, aims to determine the prevalence of key mutations associated with P. falciparum resistance to pyrimethamine (dhfr codons N51, C59, S108) in patients with uncomplicated malaria.


 MATERIALS AND METHODS

Study site
 
This study was carried out in three localities of Côte d'Ivoire (malaria endemic zone) as part of a monitoring study of antimalarial drug resistance. The study included a standard questionnaire to collect socio-demographic data from participants and blood collection for molecular testing. The study was conducted from February to August, 2015 at the Anonkoua Kouté health center and the general hospitals of Port-Bouët and Ayamé. All these sites (Anonkoua Kouté 5°25’55.90" N ; 4 02’45.27" W, Port-Bouët 5°15'20" N et 3°57'52" W and Ayamé 5°36’12,43" N ; 3°09’19,36" W) are located in the Southern region of Côte d'Ivoire where climate is  equatorial, with annual rainfall exceeding 1700 mm and temperature varies between 27 and 33°C. Malaria is seasonal, predominating in the  rainy  season  from  June  to  September  with prevalence peaks in October-November. P. falciparum is the dominant specie with more than 90% of identified malaria parasites (Adja et al., 2011). Anonkoua-kouté Health Centre, Port-Bouet and Ayamé General Hospitals were selected based on high annual incidences of malaria cases.
 
Study population and blood sample collection
 
All suspected cases of malaria at Anonkoua-kouté health center, Port-Bouët and Ayamé general hospitals were randomly selected for the study. After informed consent, patients' socio-demographic data were recorded from the questionnaire; then blood samples were collected from participants over 2 years of age and suffering from uncomplicated P. falciparum malaria detected after microscopy test. Approximately 2-5 ml of venous blood was drawn and collected in Ethylene Diamine TetraAcetic (EDTA (BD Vacutainer®-367844)) containing tube and 50 μl of whole blood was placed on Whatman 3 MM (Whatman Inc., Maidstone, United Kingdom) filter paper using a micropipette. Blood spots on filter paper were dried for approximately 60 to 120 min at room temperature. Unused blood in EDTA tube was stored in at − 20°C for further analysis.
 
Extraction of P. falciparum genomic deoxyribonucleic acid (DNA)
 
Plasmodial DNA was extracted from filter paper blood spots with methanol (Miguel et al., 2013). Indeed, fine cuts of spots were immersed in 1 ml of Wash Buffer (950 µL PBS 1X and 50 µl 10% saponin) and then incubated at 4°C overnight. The wash buffer was removed and 150 μl of methanol were added. After 20 min incubation at 4°C, the methanol was gently removed and the samples were dried at room temperature for 2 h before adding 300 μl of sterilized water. Samples were then heated at 99°C in a thermo-mixer for 30 min to extract the DNA. The DNA extracts were aliquoted into a 1.5 ml Eppendorf tube and stored at − 20°C.
 
Amplification of the pfdhfr gene
 
The pfdhfr gene was amplified by nested PCR using specific pair of primers and commercial DNA polymerase kit (5X FIREPol® Blend Master Mix (Solis Biodyne)) with mM MgCl2. This kit is a pre-mix (for the reaction mixture) ready to use composed of DNA polymerase (FIREPol® DNA polymerase), buffer (5× Blend Master Mix Buffer), MgCl2 (7.5 mM MgCl2) and dNTPs (2 mM dNTPs of each).
 
For primary PCR, the primer pairs used for amplification of the pfdhfr gene were dhfr_M1 (5'TTTATGATGGAACAAGTCTGC) / dhfr_M7 (CTAGTATATACATCGCTAACA). The primary PCR (25 μL) reaction contained 0.625 μl of each primer, 3 μl of plasmodial DNA, 5 μl of Taq DNA polymerase and 15.75 μl of milliQ water. The cycling parameters used were as follow: Initial denaturation at 95°C for 15 min followed by 30 denaturation cycles at 95°C for 30 s, annealing at 58°C for 2 min and extension at 72°C for 2 min.  Terminal extension step was set at 72°C for 10 min.
 
The second PCR was carried out on amplification products (amplicon) of the primary PCR in a reaction volume of 50 μL containing: 1.25 μl of each primer, 5 μl of amplification product (amplicon), 5 μl of Taq DNA polymerase and 37.5 μl of milliQ water. The primer pairs used for the secondary Polymerase chain reaction (PCR) were dhfr_M9 (5'CTGGAAAAA AATACATCAC ATTCATATG) /dhfr_M3 (5'T GATGGAACAAGTCTGC GACGTT). The secondary PCR cycling operation was performed as follow: Initial denaturation at 95°C for 15 min followed by 30 denaturation cycles at 95°C for 30 s, annealing at 60°C for one min and extension at 72°C for 1 min. 
 
 
 
Terminal extension step was set at 72°C for 10 min.
 
 
Detection and analysis of PCR products
 
The amplification products were transferred on a 1.5% agarose gel containing ethidium bromide (EtBr). After migration, the gel was visualized under UV lamp using the UV transilluminator (Gel DocTM EZ Imager (Bio-Rad)).
 
Sequencing amplification
 
Amplified DNA fragments (pfdhfr gene) of Plasmodium falciparum were subjected to sequencing according to the Sanger method by the Company Eurofins MWG opéron (Cochin sequencing platform). Samples were dropped in a microplate (Greiner Bio-one-652270B) that was sent to the platform for sequencing. The DNA sequences received after sequencing reaction were recovered fast. The software BioEdit was used to analyze the sequences in order to search for possible mutations.
 
Statistical analysis of data
 
Data were collected based on standard questionnaire that was tested and validated. They were analyzed using the statistical software R; version 3.2.2 (Core Team R, 2013). The χ2 comparison test of three mean values was used to compare the prevalence of the molecular marker of pyrimethamine resistance (pfdhfr S108N). The χ2 test was used to determine whether the molecular marker prevalence can be considered to be all equal (hypothesis H0) or if two or more prevalence are different (alternative hypothesis Ha). A difference and/or statistical association was considered significant if p-value < 0.05.


 RESULTS

Profile of selected patients
 
A total of 180 persons with  uncomplicated  malaria  were selected for this study, including 111 (61.66%) females and 69 (38.34%) males (Table 1). Patients’ ages ranged from 2 to 62 years, with mean ages in Anonkoua-kouté, Port-bouët and Ayamé of 16.60, 16.69 and 15.84 years respectively. Thus, 180 blood samples were collected in the study sites (Table 2).
 
DNA sequencing assessment
 
For all the study sites, 180 DNA fragments were isolated, of which 165 (165/180, or 91.66%) were successfully sequenced.  Molecular analysis of these fragments showed that the number of sequenced DNA fragments with success varied according to the presence of interest codons. Thus, 124 (75.15%), 126 (76.63%) and 155 (93.93%) DNA fragments were successfully sequenced for the nucleotides position 153, 177 and 324 corresponding to the amino acids Asn-51-Ile, Cys-59-Arg and Ser-108-Asn where mutations were observed (Table 3). Sequencing of the DNA region leading to the Ser-108- Asn mutation was more successfully performed (155/165; 93.93%).
 
 
Polymorphism of the pfdhfr gene
 
Prevalence of individual alleles of the pfdhfr gene and molecular analysis of corresponding genotypes
 
For the three study sites, our results indicated that the prevalence of isolates carrying the Ile-51 (61.29%), Arg-59 (54.76%), Asn-108 (74.19%) mutations were higher than those of wild isolates Asn-51 (15.32%), Cys-59 (15.07%), Ser-108 (17.41%) of pfdhfr gene (Table 4). Molecular  analysis  of  the  genotypes  corresponding  to pfdhfr gene showed a predominance of triple mutant (75/165, or 45.45%) and double mutant (50/165, or 30.30%) genotypes. The results also indicated that isolates carrying the IRN (triple mutant), NRN (double mutant) and ICN (double mutant) genotypes were observed with prevalence of 31.51, 9.09 and 7.87%, respectively, compared to 13.93% for isolates carrying the NCS (wild type) genotype (Table 5). Single mutant genotypes were also observed with a prevalence of 10.30%.
 
 
 
Prevalence of the Asn-108 mutation of the pfdhfr gene polypeptide in Anonkoua-Kouté, Port-Bouët and Ayamé
 
Our results showed that the Ser-108-Asn mutation was observed at 69.09%, 69.04% and 82.75% respectively for Anonkoua-Kouté, Port-Bouët and Ayamé (Table 6). For the same mutation (Ser-108-Asn), the highest prevalence was observed in Ayame (82.75%). Analysis also revealed no significant difference between  the  prevalence  of  the Ser-108-Asn mutation determined from isolates for Anonkoua-kouté, Port-Bouët and Ayamé (p = 0.344).
 


 DISCUSSION

This study indicated that in 2015, the prevalence of the Ser-108-Asn mutation (Asn-108) was observed at the same level of prevalence in Anonkoua-kouté (69.09%), Port-Bouët (69.04%) and Ayamé (82.75%). These data could be explained by the presence of P. falciparum potentially pyrimethamino-resistant isolates. The prevalence of this mutation was higher than those obtained in  2008  at  Anonkoua-Kouté  in  Abidjan  (49%) and Ayamé (54%) in blood isolates from individuals with malaria symptoms (Ako et al., 2014). Lower proportions were obtained by other authors in 2001 (50%) and 2006 (46.4%) at Yopougon in Abidjan (Djaman et al., 2002, 2010) and at Adzopé (35.4%) in 2010 (Ouattara et al., 2010).
 
In addition, a study of marker dynamics indicated that the prevalence of the Ser-108-Asn mutation increased significantly in Anonkoua-kouté between 2002 and 2008, with an average of 43% (Ako et al., 2012, 2014). In view of all these results, the prevalence of Asn-108 mutation has increased significantly in this part of the country.
 
This finding is also important because the sulfadoxine-pyrimethamine combination is recommended in intermittent preventive treatment of pregnant women in Côte d'Ivoire (MSHP, 2013). Despite its prohibition in the curative treatment of malaria attacks, SP could be used by some population in Anonkoua-kouté, Port-Bouët and Ayamé and perhaps in other towns (Granado et al., 2009, 2011).  The data obtained could also be explained by the increased use of SP (Tinto et al., 2007) in unofficial markets because of withdrawal of chloroquine. This increased use of SP could be explained by non-recommended therapeutic practices such as self-medication (Gokpeya et al., 2013; Kouadio et al., 2006) encouraged by easy access to the molecule already available in the country before 1996 (Henry et al., 1996, 2002). Indeed, Min (2012) mentioned that poor populations prefer to turn to unofficial markets to obtain SP and CQ, which remain inexpensive antimalarial molecules. According to Granado et al. (2009, 2011) and Orostegui et al. (2011), unofficial markets are found in large cities such as Abidjan or San-Pedro in Côte d'Ivoire (Granado et al., 2009, 2011; Orostegui et al., 2011). About 45 illicit sales outlets for pharmaceutical products, including various antimalarial drugs, were counted in such areas in Abidjan in 2005 (Granado et al., 2011). Populations with low purchasing power may explain the recourse to unofficial retailers (Kizito et al., 2012). This uncontrolled use of SP could promote the development of high drug pressure,   which  could  lead  to  the  selection  of resistant parasites at Anonkoua-kouté, Port-bouët and Ayamé.
 
In addition to drug pressure, pyrimethamine resistance in these three localities could be explained by the use of poor quality antimalarial drug. Indeed, the use of poor-quality antimalarial drug can have multiple consequences, including an increased risk of developing drug resistance, as sub-therapeutic doses of drugs will be ineffective in destroying all parasites (Newton et al., 2010; Shunmay et al., 2015).
 
Elsewhere in sub-Saharan Africa, high rates of P. falciparum resistance have been found. Indeed, results of monitoring for P. falciparum chemo resistance have shown the following results: in Burkina Faso, the reported rate of Asn-108 mutation was 63.8% (Somé et al., 2016); 92% in Gabon (Ghyslain et al., 2011); 93% in Senegal (Daouda et al., 2013). As the Asn-108 mutation, additional mutations (Asn-51-Ile and Cys-59-Arg) have also been identified. All mutations at codons 51 and 59 were associated with that of codon 108. Parasites carrying these additional Asn-51-Ile and Cys-59-Arg mutations associated with the Ser-108-Asn mutation have higher pyriméthamine resistance than those carrying the Ser-108-Asn mutation alone (Mathieu et al., 2007; Gregson and Plowe, 2005). Compared to the prevalence of 17.33 and 27.27% reported by Ako respectively for Dabakala, Anonkoua-Kouté, Ayamé sites (Ako et al., 2012, 2014)  and  Bonoua  and  Samo  sites (Ako et al., 2012), the prevalence of the triple mutant IRN (31.51%) increased compared to the sensitive strain (NCS). A high prevalence of triple-mutant P. falciparum parasites reduces the efficacy of sulfadoxine-pyrimethamine as an intermittent preventive treatment against malaria in infants and children (Gosling et al., 2009; Nankabirwa et al., 2010), undermines the ability of sulfadoxine-pyrimethamine to clear existing P.  falciparum infections in asymptomatic pregnant women, and shortens the post-treatment prophylactic period, following Intermittent Preventive Treatment during pregnancy (Desai et al., 2016).


 CONCLUSION

The study indicates that the prevalence of alleles associated with pyrimethamine chemoresistance represented by the dhfr Asn-108 mutation has increased in Anonkoua-kouté, Port-Bouët and Ayamé. It also indicates an increase in the prevalence of the genotypes that confer pyrimethamine resistance. The study revealed an increase in potentially pyrimethamino-resistant isolates despite the withdrawal of SP as a first-line antimalarial treatment. These high proportions of known mutations in the pfdhfr gene could be in favour of a decrease in the SP efficacy in Côte d'Ivoire.

 


The study was conducted in accordance with the Declaration of Helsinki and approval was received from the National Committee for Ethics and Research (CNER) of the Ministry of Health and AIDS of Côte d'Ivoire. After appropriate information and explanation, the adult participants, parents or legal guardians of all children who wished to participate in the study gave their written consent prior to sampling.



 REFERENCES

Adja AM, N'goran EK, Koudou BG, Dia I, Kengne P, Fontenille D, Chandre F (2011). Contribution of Anopheles funestus, An. gambiae and An. nili (Diptera: Culicidae) to the perennial malaria transmission in the southern and western forest areas of Côte d'Ivoire. Annals of Tropical Medicine and Parasitology 105:13-24.
Crossref

 

Adnan Y, Aamer AK, Muhammad FN, Huma F, Gillian M, Amed O, Matthew A, Nadia Z, Takala‑Harrison S (2018). Prevalence of molecular markers of sulfadoxine-pyrimethamine and artemisinin resistance in Plasmodium falciparum from Pakistan. Malaria Journal 17:471.
Crossref

 
 

Ako AAB, André TO, Marnie J, Louis KP, Simon-Pierre AN, Carol HS (2012). Molecular analysis of markers associated with chloroquine and sulfadoxine/pyrimethamine resistance in Plasmodium falciparum malaria parasites from southeastern Côte-d'Ivoire by the time of Artemisinin-based Combination Therapy adoption in 2005. Infection and Drug Resistance 5:113-120.
Crossref

 
 

Ako AB, Toure OA, Johansson M, Traore R, Gbessi AE, Coulibaly MY, Nguetta SA, Koné PL, Hopkin SC (2014). Sulfadoxine-Pyrimethamine Resistant Haplotypes in Asymptomatically and Symptomatically Malaria Infected Individuals in Côte d'Ivoire. Malaria Chemotherapy Control and Elimination 3:1-10.

 
 

Core Team R (2013). A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. ISBN 3-900051-07-0.

 
 

Daouda N, Baba D, Yaye DN, Daria VT, Rachel D, Amy KB, Aminata M, Clarissa V, Amanda L, Souleymane M, Omar N, Dyann FW, Sarah V (2013). Polymorphism in dhfr/dhps genes, parasite density and ex vivo response to pyrimethamine in Plasmodium falciparum malaria parasites in Thies, Senegal. International Journal for Parasitology: Drugs and Drug Resistance 3:135-142.
Crossref

 
 

Desai M, Gutman J, Taylor SM, Wiegand RE, Khairallah C, Kayentao K, Ouma P, Coulibaly SO, Kalilani L, Mace KE, Arinaitwe E, Mathanga DP, Doumbo O, Otieno K, Edgar D, Chaluluka E, Kamuliwo M, Ades V, Skarbinski J, Shi YP, Magnussen P, Meshnick S, Ter Kuile FO (2016). Impact of sulfadoxine-pyrimethamine resistance on effectiveness of intermittent preventive therapy for malaria in pregnancy at clearing infections and preventing low birth weight. Clinical Infectious Diseases 62:323-33.
Crossref

 
 

Djaman J, Ahibo H, Yapi HF, Bla KB, Ouattara L, Yavo W, N'guessan JD, Yapo A, Mazabraud A (2010). Molecular Monitoring of Plasmodium falciparaum Malaria isolates in Côte d'Ivoire: Genetic Markers (dhfr-ts, dhps, pfcrt, pfmdr-1) for antimalarial-drugs resistance. European Journal of Scientific Research 40:461-470.

 
 

Djaman AJ, Basco L, Mazabraud A (2002). Mise en place d'un système de surveillance de la chimiorésistance de Plasmodium falciparum à Yopougon (Abidjan) : étude in vivo de la sensibilité à la chloroquine et évaluation de la résistance à la pyriméthamine après analyse de la mutation ponctuelle du gène de la dihydrofolate reductase (dhfr). Cahiers Santé 12:363-367.

 
 

Ghyslain MN, Sunny O, Rosalynn O, Julian JG, Katja CG, Katharina P, Benedikt G, Florian K, Bertrand L, Jürgen FJ, Saadou I, Cally R, Peter GK, Martin PG (2011). High prevalence of dhfr triple mutant and correlation with high rates of sulphadoxine pyriméthamine treatment failures in vivo in Gabonese children. Malaria Journal 10:123.
Crossref

 
 

Gokpeya MB, Sackou KJ, Hounsa A, Oga S, Kouadio KL, Houénou Y (2013). Paludisme à Abidjan: Connaissances, attitudes, pratiques des meres d'enfants De 0 A 5 Ans. Caher de Santé Publique 12(1):53-60

 
 

Gosling RD, Gesase S, Mosha JF, Carneiro I, Hashim R, Lemnge M, Mosha FW, Greenwood B, Chandramohan D (2009). Protective efficacy and safety of three antimalarial regimens for intermittent preventive treatment for malaria in infants: a randomised, double-blind, placebo-controlled trial. Lancet 374:1521-1532.
Crossref

 
 

Granado S, Manderson L, Obrist B, Tanner M (2011). Appropriating "Malaria": local responses to malaria treatment and prevention in Abidjan, Côte d'Ivoire. Medical Anthropology 30:102-121.
Crossref

 
 

Granado S, Obrist B, Manderson L, Tanner M (2009). The moment of sale: Treating malaria in Abidjan, Côte d'Ivoire'. Anthropology and Medicine 16:319-331.
Crossref

 
 

Gregson A, Plowe CV (2005). Mechanisms of resistance of malaria parasites to antifolates. Pharmacological Reviews 57:117-145.
Crossref

 
 

Henry MC, Eggelte A, Watson P, van Leeuwen D, Bakker DA, Kluin J (1996). Response of childhood malaria to Chloroquine and Fansidar in an area of intermediate Chloroquine résistance in Côte d'lvoire. Tropical Medicine and International Health 1:610-615.
Crossref

 
 

Henry MC, Niangué J, Koné M (2002). Quel médicament pour traiter le paludisme simple quand la chloroquine devient inefficace dans l'Ouest de la Côte d'Ivoire ? Médecine Tropicale 62:55-57.

 
 

Ingrid BM, John EH (2010). Antimalarial drugs: modes of action and mechanisms of parasite resistance. Future Microbiology 5(12):1857-1873.
Crossref

 
 

Kasturi H, Souvik B, Innocent S (2018). Drug resistance in Plasmodium. Nature Reviews Microbiology 16(3): 156-170.
Crossref

 
 

Kizito J, Kayendeke M, Nabirye C, Staedke SG, Clare IR, Chandler (2012). Improving access to health care for malaria in Africa: a review of literature on what attracts patients. Malaria Journal 11:1-14.
Crossref

 
 

Kouadio AS, Cissé G, Brigit O, Kaspar W, Zingsstag J (2006). Fardeau économique du paludisme sur les ménages démunis des quartiers défavorisés d'Abidjan, Côte d'Ivoire. VertigO - la revue électronique en sciences de l'environnement Hors-série 3. 
Crossref

 
 

Mathieu N, Rachida T, Leonardo KB, Prisca NC, David AM, Francine N (2007). Therapeutic efficacy of sulfadoxine-pyrimethamine and the prevalence of molecular markers of resistance in under 5-yearolds in Brazzaville, Congo. Tropical Medicine and International Health 12(10):1164-1171.
Crossref

 
 

Miguel RH, Coura JR, Samudio F, Suárez-mutis MC (2013). Evaluation of three different DNA extraction methods from blood samples collected in dried filter paper in Plasmodium subpatent infections from the Amazon region in Brazil. Revista do Instituto de Medicina Tropical de São Paulo 55(3):205-208.
Crossref

 
 

Min H (2012). Mapping the supply chain of anti-malarial drugs in Sub-Saharan African countries. International Journal of Logistics Systems and Management 11:1-23.
Crossref

 
 

MSHP (2013). Directives nationales de prise en charge du paludisme en Côte d'Ivoire. Abidjan, Côte d'Ivoire , Ministère de la Santé et de l'Hygiène Publique. 37p.

 
 

Nankabirwa J, Cundill B, Clarke S, Kabatereine N, Rosenthal PJ, Dorsey G, Brooker S, Staedke SG (2010). Efficacy, safety, and tolerability of three regimens for prevention of malaria: a randomized, placebo-controlled trial in Ugandan schoolchildren. PLoS ONE 5:e13438.
Crossref

 
 

Newton PN, Green MD, Fernandez FM (2010). Impact of poor-quality medicines in the 'developing' world. Trends in Pharmacological Sciences 31:99-101.
Crossref

 
 

Orostegui L, Balu L, Chevret L, Habes D, Pussard E (2011). Community Management of Anti-malarials in Africa and Iatrogenic Risk. Journal of Tropical Pediatrics 57:225-226.
Crossref

 
 

Ouattara L, Bla KB, Assi SB, Yavo W, Djaman AJ (2010). pfcrt and dhfr-ts Sequences for Monitoring Drug Resistance in Adzopé Area of Côte d'Ivoire After the Withdrawal of Chloroquine and Pyrimethamine. Tropical Journal of Pharmaceutical Research, December 9(6):568.
Crossref

 
 

Picot S, Olliaro P, de Monbrison F, Bienvenu AL, Price RN, Ringwald P (2009). A systematic review and meta-analysis of evidence for correlation between molecular markers of parasite resistance and treatment outcome in falciparum malaria. Malaria Journal 8:89.
Crossref

 
 

Ratcliff A, Siswantoro H, Kenangalem E, Wuwung M, Brockman A, Edstein MD, Laihad F, Ebsworth EP, Anstey NM, Tjitra E, Price RN (2007). Therapeutic response of multidrug-resistant Plasmodium falciparum and P. vivax to chloroquine and sulfadoxine-pyriméthamine in southern Papua, Indonesia. Transactions of the Royal Society of Tropical Medicine and Hygiene 101:351-359.
Crossref

 
 

Ravi KU (2016). Emergence of drug resistance in Plasmodium falciparum: Reasons of its dispersal and transmission in different climatic regions of the world: a review. Clinical Microbiology and Infectious Diseases 1(2):45-55.
Crossref

 
 

Sankar S, Shannon KM, Luke MS, Karen MH, John WB, Venkatachalam U (2010). Antifolate drug resistance in Africa: meta-analysis of reported dihydrofolate reductase (dhfr) and dihydropteroate synthase (dhps) mutant genotype frequencies in African Plasmodium falciparum parasite populations. Malaria Journal 9:247.
Crossref

 
 

Shannon T-H, Miriam KL (2015). Antimalarial drug resistance in Africa: key lessons for the future. Annals of the New York Academy of Sciences 1342:62-67.
Crossref

 
 

Shunmay Y, Harriet LS, Lawford, Tabernero P, Nguon C, van Wyk A, Malik N, DeSousa M, Rada O, Boravann M, Dwivedi P, Hostetler DM, Swamidoss I, Green MD, Fernandez FM, Kaur H (2015). Quality of Antimalarials at the Epicenter of Antimalarial Drug Resistance: Results from an Overt and Mystery Client Survey in Cambodia. The American Journal of Tropical Medicine and Hygiene 92(Suppl 6):39-50.
Crossref

 
 

Somé AF, Sorgho H, Zongo I, Bazié T, Nikiéma F, Sawadogo A, Zongo M, Compaoré YD, Ouédraogo JB (2016). Polymorphisms in K13, pfcrt, pfmdr1, pfdhfr, and pfdhps in parasites isolated from symptomatic malaria patients in Burkina Faso. Parasite 23:60.
Crossref

 
 

Tinto H, Ouédraogo JB, Zongo I, Van Overmeir C, Van Marck E, Guiguemdé TR, D'Alessandro U (2007). Sulfadoxine-pyrimethamine efficacy and selection of Plasmodium falciparum DHFR mutations in Burkina Faso before its introduction as intermittent preventive treatment for pregnant women. American Journal for Tropical and Medicine Hygiene 76:608-613.
Crossref

 
 

Vladimir C, Murillo C, Echeverry DF, Benavides J, Pearce RJ, Roper C, Guerra AP, Osorio L (2010). Origin and Dissemination across the Colombian Andes Mountain Range of Sulfadoxine-Pyrimethamine Resistance in Plasmodium falciparum. Antimicrobial Agents and Chemotherapy 54(8):3121-3125
Crossref

 
 

WHO (2018). World Malaria report 2018. Geneva: World Health Organization; 2018. ISBN 978-92-4-156565-3

 
 

WHO (2016). WHO Policy recommendation on Intermittent Preventive Treatment during infancy with sulphadoxine-pyrimethamine (SP-IPTi) for Plasmodium falciparum malaria control in Africa.  

 
 

Yaro A (2009). Mechanisms of sulfadoxine pyrimethamine resistance and health implication in Plasmodium falciparum malaria: A mini review. Annals of Tropical Medicine and Public Health 2(1):20.

 

 




          */?>