Valsaceae mitosporico belongs to the genus, Phomopsis; phylumm Ascomycota; subphylum, Pezizomycotin; class, Sordariomycetes; subclass, Sordariomycetidae; order, Diaporthales; family, Valsaceae. Diaporthe is the telemorphic form of the genus, Valsaceae (Hanlin and Menezes, 1996). This genus has been isolated as an endophyte in several vegetable crops such as Theobroma cacao L. (Rubini et al., 2005), Spondias mombin L. (Rodrigues et al., 2000), Aspidosperma tomentosum (Corrado and Rodrigues, 2004), Heterosmilax japonica Kunth (Gao et al., 2005), among others.

Fungi are considered as promising sources of new drugs for therapeutic use and in fact, several medicines used in health centers are derived from fungal metabolites. In the past two decades, a group of microorganisms that stood out for the production of bioactive metabolites were endophytes, especially fungi. Endophytic microorganisms are found in many species of medicinal plants. Stierle et al. (1995) reported that the fungus Taxomyces andreanae, taxol-producing endophytic and other taxanos, that live in the interior of the medicinal plant, T. brevifolia, is used for cancer treatment.

According to Arbo (2004), the family Turneraceae has 10 genus and around 190 species with a wide distribution in tropical and subtropical regions of the world, with tropical America being the diversity Center of these species. The genus Turnera presents about 120 species scattered in the Americas and Africa, being the most representative of the family Turneraceae (Barbosa et al., 2007).

For every moment, more is known about the interaction between plants and endophytic microorganisms, as well as the new species found in symbiosis and the wealth of metabolites produced by them. Chen et al. (2014), in his review, discusses the evolution and discoveries of endophytic fungi. Malhadas et al. (2017) describe the antimicrobial activity of Penicillium species isolated from olive leaves, as well as the identification of their compounds. In view of the above, the goal of this study is to isolate and evaluate the antimicrobial potential of Phomopsis spp. isolated from Turnera subulata leaves.

Isolation and purification of endophytic fungi from T. subulata

Leaves of T. subulata without symptoms of diseases or mechanical injuries were collected in the urban region of Maceio city and taken to Laboratory of Biotechnology of Plants and Endophytic Microorganisms where  they  were  promptly  washed  with  running water. All the materials were disinfected superficially through the following protocol: 1) the vegetal sample was washed in alcohol (70% v/v) for 1 min; 2) the material was washed in sodium hypochlorite (0.20% w/v) plus two drops of commercial detergent for 20 min and 3) triple washing in sterile distilled water.

After cleaning and disinfecting the T. subulata samples with 1 cm of diameter, they were inoculated on petri plates containing potato dextrose agar (PDA) medium, and incubated for five days at room temperature on mycelial growth. After incubation, each microorganism colony was taken as a sample of the vegetative mycelium and inoculated in PDA medium for six days under continuous light at temperature of 25°C (±3°C). After growth, the samples were checked on optical microscopy to verify the purity of the isolated fungal colonies.

Prior to the identification of the fungi isolated, micro culture methodology was done. The colony was scraped before it was grown in petri dishes containing PDA medium. Thereafter it was inoculated on slides with a drop of the same culture medium on an equilateral triangle and damp cotton with sterile water to grant moisture required for fungal growth. It was incubated for three days under continuous light.

After this procedure, slides were stained with bromophenol blue and observed by optical microscopy to determine the presence of the fungus Phomopsis spp. based on its morphologic characteristics.

DNA extraction from the endophytic fungus

The endophytic fungus isolated from T. subulata L. was grown in 100 ml of liquid medium potato dextrose (PD), at 23 to 25°C without agitation for four days. Such samples were forwarded to Forensic DNA Laboratory at the Natural History Museum of the Federal University of Alagoas for DNA extraction and subsequent sequencing of the prevalence of ITS2 regions (internal transcribed spaces 1 and 2, respectively) of rDNA.

The mycelium of Phomopsis sp. was isolated from the culture medium by centrifugation for 10 min at 7000 rpm (after the fourth day of growth) and subjected to DNA extraction using the CTAB protocol (Ferreira and Grattapaglia, 1995). After the extraction, DNA was stored at 4°C. The amplification of the rDNA was performed by PCR. Specific primers of Write et al. (1990) were used for the amplification of the prevalence of ITS1 and ITS2 regions.

The fragments produced were separated by capillary electrophoresis in automatic sequencer ABI Prism 310 Genetic Analyzer, using polymer POP6 (Applied Biosystems, Foster City, CA, USA). An analysis of the Electropherograms was made using the program SeqScape v2.5. The mixed sequence obtained was 515 nucleotides and was analyzed using the BLAST program of NCBI, which allowed for the comparison percentage of similarity found with the data available in NCBI (National Center for Biotechnology Information) (www.ncbi.nlm.nih.gov).

Chemical prospecting from the mycelium of Phomopsis sp.

Erlenmeyer, containing PD medium and inoculated with a fungal disk in a diameter of approximately 5 mm, was incubated in the dark without aeration at 25 (±3°C) for the production of biomass. After 30 days of cultivation, the biomass was filtered and taken to kiln drying at 45°C until dry mass was obtained. The dry biomass was removed through maceration with n-hexane (5 x 250 mL), chloroform (5 × 250 mL), ethyl acetate (5 x 250 mL) and methanol (5 x 250 mL).

Preparation of samples and determination of IC₅₀

The stock solutions of  the  samples  (dry extracts; 40 mg/mL)  were prepared from the dissolution of each sample in methanol (HPLC grade). From these solutions were prepared dilutions in concentrations of 30, 20 and 10 mg/ml. Five experiments of dried extracts were performed with each of the solutions (10 to 40 mg/ml). Reaction mixtures consisting of 0.1 ml of the test solution and 0.9 ml of stock solution of DPPH 40 mg/ml (~100 μmol/L) were prepared and the measures of absorbance of each were made at 515 nm, in triplicate every 15 min, for 1 h.

Antimicrobial activity of extracts of Phomopsis sp against human pathogenic microorganisms

Hexane, chloroform, ethyl acetate and partition of the mycelium and extract in ethyl acetate of the culture filtrate of Phomopsis sp were tested against E. coli (ATCC 8739), S. aureus (ATCC 6538), Candida albicans (URM 4126), C. tropicalis (URM 4977) and C. glabrata (CCIBM), through the agar diffusion method, described by Bauer et al. (1996). All strains are deposited in the culture bank of Microbiology Laboratory of the Institute of Biological Sciences and Health (ICBS).

The extracts were diluted in six different concentrations. Then 20 µL of each concentration was added to Whatman filter discs paper No. 5 (0.5 cm) that was properly sterilized and put in holes of approximately 5 mm with the aid of a puncher of agar. For inoculation, we used 100 µL of each bacterial suspension/yeast, depositing the same through agar nutrient in petri dishes. Then paper discs containing extracts were added. Each test was done in three repetitions in a completely randomized design.

From the leaf fragments of T. subulata, it was possible to isolate a filamentous fungus that has been identified by classical methods of microscopy and molecular as the fungus Phomopsis sp.. Until now, this is the first report on the isolation of the fungus Phomopsis sp. as endophyte of T. subulata leaves.

The fragment from the region of Phomopsis sp. isolate obtained from T. subulata presented 439 pb (pairs of bases) arranged in the following way: 5’CCCTTTGTGAACTTATACCTATTGTTGCCTCGGCG AGGCCGGCCTCTTCACTGAGGCCCCCTGGAAACAGGGAGCAGCCCGCCGGCGGCCAACTAAACTCTTGTTTCTATAGTGAGTCTCTGAGTAAAAAACATAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCTGGCTTGGTGATGGGGCACTGCCTTCTAGCGAGGGCAGGCCCTGAAATCTAGTGGCGAGCTCGCTAGGACCCCGAGCGTAGTAGTTATATCTCGTTCTGGAAGGCCCTGGCGGTGCCCTGCCG 3’

Using bioinformatics tool BLAST (Basic Local Alignment Search Tool) on the site http://blast.ncbi.nlm.nih.gov/ blast, this sequence was compared to the other existing ones in this region strings; it was recorded in the database of the program where the isolates of Phomopsis and Diaporthe were obtained. It was also possible, through this tool, to obtain a sequence dichotomous tree compared to sequences from the NCBI database (Figure 1).

After cultivating the isolate in a liquid medium for 30 days, with a total of approximately 16 g of dry biomass isolated from Phomopsis sp. (about 0.4 g per 100 ml of culture medium), the following quantities of extracts were obtained: n-hexane, 1.68 g; chloroform, 1.28 g; ethyl acetate, 0.72 g; and methanol, 1.92 g, showing an approximate sum of 35% extracts obtained from the total dry biomass (Table 1).

Phomopsis sp. fungus may be able to act as an endophyte of the plant T. subulata, as shown in this first report of its isolation in leaves of this plant. Although it has low antimicrobial activity, the same fungus must be tested with other target microorganisms, besides using other methodologies to identify its compounds.

The authors have not declared any conflict of interests.