ABSTRACT
Random amplification of polymorphic DNA (RAPD) amplification genomic DNA of 23 selected laboratory cultures of bacteria using RAPD revealed their polymorphism. Polymerase chain reaction (PCR) amplification of the bacterial 16SrDNA was performed using 704F GTAGCGGTGAAATGCGTAGA and 907R CCGTCAATTCCTTTGAGTTT primer, sequenced and accessed in NCBI (No. KY636356, KY631488, KY 860028, KX587470, KX665547, KY631489, KX608591, KY636360, KY671245, KY631490, KX587469, KY859856, KX665546, KX608590, KX587468, KY859798, KY636357, KY636361, KY 636359, KY631491, KY 859855, KY636358, KY636362) after submitting the contig. FASTA sequence in NCBI database was seen. All most all 23 bacterial strains (viz. TS-1-16, TS-4-23 DJ-1-22, DS-1-20, AS-1-4, DJ-1-24 , DJ-1-10, DJ-1-46) showed strong homology with free living nitrogen fixing soil bacteria, also showing (98 to 100%) identity and E-value of 00 with Burkholderia spp, Strain-S-9-19, Str-S-9-15, SP-2386, Stenotrophomonas maltophilla, strn-MM-3-3, Str-D-3,LP-05, Bacillus cereus Strn-FORC021and Azospirillum sp TSH51 gene, having good nitrogen fixing capacity. Phylogenetic tree analysis among the 23 isolates and between the different strains from GenBank showed close similarity. Most of the isolated bacterial strain identified as a member of the genus Burkholderia sp, Stenotrophomonas maltophila, Herbaspirillum sp, Acinetobacter johnsonii, Methylobacter, SP-T-20, and Bacillus cereus, Azospirillum sp would be consider to be the most suitable bioferiliser for organic and conventional tea gardens of North Bengal, India.
Key words: Molecular phylogeny, RAPD, 16SrRNA sequencing, free living, N2 fixing soil bacteria.
Tea Camellia sinensis (L) O. “Kuntze” of family Theaceae is the most commonly used beverage in India and in the world. Tea is an evergreen shrub that mainly grows in tropical and subtropical areas. It is thought to have
originated in East Asia somewhere between China and Burma. India is the world’s second largest tea producer country next to China. In the financial year 2015 to 2016, India has recorded tea production of 1,233 million kg (mn kg) and exports crossing 230 mn kg after 35 years. The top five teas producing countries are China, India, Kenya, Sri Lanka and Turkey (http://www.gktoday.in/blog/key-facts-about-tea-production-in-india/). India has around 563.98 thousand hectares of tea cultivated land (December 2013). Assam is the highest Indian agricultural soil that contains low nitrogen and cellulose, and therefore the self-sustaining free-living nitrogen-fixing micro flora would be of great advantage if their identity is known and their ability is properly exploited. The reduction of chemical fertilizers by the application of biological fertilizers is mainly based on the bacteria involved in nitrogen fixation as one of the suitable steps in sustainable agriculture (Vejan et al., 2016).
The plant growth promoting rhizobacteria (PGPR) microorganisms play beneficial effects on the plant health (
Philippot et al., 2013) directly by nitrogen fixation, different phytohormone production, phosphate solubilisation and iron sequestration by siderophore production and indirectly by plant growth stimulation by producing antifungal metabolites preventing different phytopathogens (
Glick and Bashan, 1997). Diverse bacterial genera such as
Arthrobacter, Azospirillum,
Azotobacter,
Bacillus,
Pseudomonas,
Klebsiella,
Burkholderia,
Erwinia,
Flavobacterium,
Micrococcous,
Enterobacter,
Xanthomonas,
Chromobacterium,
Serratia and
Caulobacter spp have been reported to increase plant growth (Bhattacharyya and Jha, 2012;
Bal et al., 2013). Rhizospheric
Azospirillum sp of many grasses and cereals is a well known PGPR all over the world. Presently, N
2 fixing PGPR that have plant stimulation includes the endophytes that is,
Azoarcus,
Burkholderia,
Herbaspirillum spp and
Gluconacetobacter diazotrophicus, and the rhizospheric bacteria
Azotobactersp and
Paenibacillus (Bacillus) polymyxa (Vessey, 2003).
In recent times, PGPR got more attention and it has been used as potent biofertilizers (
Richardson et al., 2009;
Compant et al., 2010) as prolonged use of chemical fertilizers is perilous to soil, as well as, human health and also detiorate the crop quality (
Islam et al., 2013). Alternative biotechnological approaches are adapted in different agriculture practices to not only increase the crop production and plant growth, but also to maintain soil health. It has been reported that inoculation of
Azospirillum biofertiliser or liquid near the rhizosphere of tea significantly increased growth. Although, research about PGPR impact on the tea plants is still poorly organized, especially in the Northeast region of India including North Bengal tea growing region. The productivity of tea is decreased remarkably due to intensive application of chemical fertilizers for a prolonged period (Sharma et al., 2014).
Therefore, there is a growing demand to explore the indigenous micro flora associated with the tea rhizosphere soil not only to reduce the application of chemical fertilizer, but also for the benefit of plant, soil health and the environment. The 16S rRNA represents the right candidate to study bacterial evolution, ecology, phylogenetic relationships among taxa, bacterial diversity and quantification of the relative abundance of taxa of various ranks (Hugenholtz et al., 1998). Whereas, random amplified polymorphic DNA (RAPD) fingerprinting explores genetic polymorphisms (Teaumroong and Boonkerd, 1998) in bacteria. RAPD fingerprinting has been used for strain identification and to determine the genetic diversity within a field population of pink-pigmented facultative methylotrophs (Balachandar et al., 2008), Rhizobium isolates (Rajsundari et al., 2009), Photorabdus and Xenorabdus isolates (Moghaieb et al., 2017).
There was scanty report on molecular identification of free living N2 fixing PGPR of North Bengal tea gardens of West Bengal. A preliminary investigation on isolation and characterization of free-living soil bacteria from tea gardens of Terai, Dooars and Darjeeling district West Bengal have been carried by the present research group. Morphological and biochemical evaluation of free living N2 fixing tea rhizospheric and tea soil bacteria of North Bengal tea gardens has also been investigated (Bhaduri et al., 2018).
Keeping the background information, the present study has been undertaken for molecular identification and to understand the genetic diversity of free living N2 fixing soil bacteria from tea garden soil of North Bengal to be used as biofertiliser.
Pure cultures of previous study (Bhaduri et al., 2018) were used as experimental sample for this investigation, 23 strains for 16SrRNA analysis and 22 strains for RAPD analysis (El-Fiki, 2006).
Isolation of genomic DNA
Genomic DNA was isolated from selected pure bacterial isolates of three different region sample screened on the basis of salt tolerance, antibiotic resistance total N content, etc. following the cetyl trimethylammonium bromide (CTAB) method (Gomes et al., 2000). The isolated genomic DNA was treated with RNase and then subjected to Agarose Gel (0.8%) electrophoresis to check the purity of DNA.
RAPD
Random Amplification of Polymorphic DNA of selected strains to observe the genetic variability between them was carried out at Xcelris Lab. Ahmedabad, Gujrat using two RAPD primer P1v(5' to 3'): GTG TGT GTG TGT GTG TGT GT, (20) nts., El-Fiki 2006 and P2:OPQ1 (5' to 3'): GGGACGATGG (10) nts (Balachandar et al., 2008; Rajsundari et al., 2009; Moghaieb et al., 2017). PCR was carried out in a final reaction volume of 25 μl in ABI Veriti Thermal Cycler. Amplification reactions were performed in a 25 μL volume, containing: 20 mM Tris-HCl (pH 8.4), 50 mMKCl, 2.5 mM MgCl2, 200 μM each of dNTPs, 1 μM primer, 30 ng of genomic DNA and 1.5 U of Taq DNA polymerase. The reaction mixture was flooded with two drops of mineral oil, initial denaturation for 5 min at 95°C, the amplification, then continued for 35 cycles consisting of 30 s at 94°C, 30 s at 36°C and 60 s at 72°C followed by a 7 min final extension at 72°C. Amplification product was separated by gel electrophoresis on precast 1.2% agarose gel and visualized under ultra-violent (UV) illumination after staining with ethidium bromide and Gel Documented on Gel Documentation System (Lee et al., 2012).
PCR amplification of 16SrRNA gene
PCR amplification of 16SrRNA was performed using 8F AGAGTTTGATCCTGGCTCAG. 1492R ACGGCTACCTTGTTACGACTT and sequencing of isolated bacterial 16SrRNA was performed using 704F GTAGCGGTGAAATGCGTAGA and 907R CCGTCAATTCCTTTGA GTTT primer. PCR amplification conditions: DNA1 μl, 16S Forward Primer 400ng, 16S Reverse Primer 400ng, dNTPs (2.5 mM each) 4 μl, 10X Taq DNA polymerase Assay Buffer 10 μl,Taq DNA Polymerase Enzyme (3U/ μl) 1 μl,Water X μl,Total reaction volume 100 μl. The PCR was conducted at 95°C, 94°C, 50°C ,72°C, 72°C, 5 min, 30 s, 30 s, 1 min 30 s and 7 min respectively for 35 cycles (protocol followed by Xcelris Lab) .
Sequencing of 16S rRNA
The PCR amplicon (1.4 kb approximately) was purified with ExoSap enzymatic purification as per the manufacturer,s instruction (ABI). After the purification, the products were subjected to Sanger sequencing using ABI, 3730XL DNA analyzer using BdT v3. 1 chemistry. Each forward and reverse reaction of PCR amplified products were sequenced separately. Forward and Reverse DNA sequencing reaction of PCR amplicons of respective samples was carried out using BDT v3. 1 Cycle sequencing kit on ABI 3730xl Genetic Analyzer.
Construction of phylogenetic tree
The evolutionary history was inferred by using the Maximum Likelihood method based on the Tamura et al. (2004) model. Evolutionary genetics analysis uses maximum likelihood, evolutionary distance, and maximum parsimony methods were conducted in MEGA 5 software (Tamura et al., 2011). The RAPD profile derived phylogeny was performed by Xcelris Lab.
Purified genomic DNA isolated from bacterial strains after resolving in 0.8% agarose gel reveals their good yield and large genome size (Figure not shown).
PCR amplification of 16SrRNA gene and sequencing
Twenty three isolated bacterial genomic DNA was amplified with forward and reverse sequencing primer. PCR amplified fragments of approximately 1.4 kb in size are sequenced.
GenBank accession followed by homology searching
Twenty three (23) GenBank Accession were obtained after submitting the contig FASTA sequence. Most of the 23 isolated bacterial strain demonstrated strong homology with known nitrogen fixing bacteria. The strain TS-1-16 (Accession No. KY636356) displayed 100% homology with Burkholderia sp, Strain-S-9-19 (Accession No. KY357337) having nitrogen fixing capacity was ascribed as a member of the genus Burkholderia, since our sequence was not full length. TS-4-23 (Accession No. KY631489) showed 100% identity along with Burkholderia sp, Str-S-9-15 (Accession No. KX212131) having good nitrogen fixing capacity. DS-1-20 (Accession No. KY636360) showed 100% identity with Stenotrophomonas maltophilla, strn-MM-3-3, (Accession No. KT970988) having nitrogen fixing capacity and the other Stenotrophomonas species, hence it is ascribed as a member of the genus Stenotrophomonas. DJ-1-22 (Accession No. KY 859855) showed 100% identity with Burkholderia SP-2386, (Accession No.JX174263) having good nitrogen fixing capacity. AS-4 (Accession No.KY636361) showed 100% identity with S. maltophilla, Str-D-3 (Accession No. KM488439) having nitrogen fixing capacity. The bacterial strains DJ-1-24 (Accession No. KY636358) showed 100% identity with S. maltophilla-LP-05 (Accession No. KT427904), DJ-1-10 (Accession No. KY631491) 99% identity with Bacillus cereus Strn-FORC021 (Accession No. CP-014486), DJ-1-46 (Accession No. KY636362) 98% identity and with Azospirillumsp TSH51 gene, (Accession No. AB508854) having nitrogen fixing capacity, the latter is well known free living nitrogen fixing soil bacteria (Table 1).
Evolutionary genetics analysis and phylogenetic tree
Phylogenetic tree analysis between the 23 isolated strains showed close similarity among the strains. The tree reveals that there are 8 main groups consisting of two closely related strains. The group 1 consists of strains of TS-4-23 and DS-1-16 which resembles the Burkholderia sp functioning as a free living N2 fixer and belonging to PGPR activity (Hayat et al., 2010).
Grou p 2 contained strains of TS-4-12 and DJ-1-46 which resembles the Burkholderia cepacia and Azospirillum sp TSH51 gene, which solely functions as a free living N2 fixer and displaying PGPR activity. Group 3 contained strains of DJ-1-3 and DJ-1-22 which resembles the Burkholderia sp different strain which solely functions as a free living N2 fixer and PGPR activity. Group 4 contained strains of AS-4 and DJ-1-24 which resembles the S. maltophilla different strain which solely functions as a free living N2 fixer and PGPR activity (Fouzia et al., 2015).
Group 5 contained strains of TS-3-15 and DS-1-20 which resembles the S. maltophilla different strain which solely functions as a free living N2 fixer and PGPR activity. Group 6 contained strains of TS-3-27 and DJ-1-10 which resembles the Bacterium str-CH-2 and Bacillus cereus strn-FORC021which solely functions as a free living N2 fixer and PGPR activity. Group 7 contained strains of TS-4-16 and DS-2-10 which resembles Herbaspirillum sp different strain which solely functions as free living as well as endophytic (certain strain) N2 fixer and PGPR activity in tea plant (Zhan et al., 2016).
Group 8 contained strains of DS-2-8 and DS-2-9 which resembles Methylobacter, SP-T-20 and uncultured Ralstonia sp., Clone-3P-3-2 which solely functions as a free living N2 fixer and PGPR activity. The other seven strains are distantly related to these clusters having nitrogen fixing and plant growth promoting activity (Figure 1) (Hayat et al., 2010).
RAPD
RAPD analysis of isolated bacterial genomic DNA reveals a little polymorphism pattern (Figure 2). Among the two primers tested only primer P1 was proper for amplification. The bacterial isolates DS-2-10; DS-2-8; DS-1-25; TS-4-24 gave no response at RAPD amplification and rest of the 18 isolates showed amplification. The DNA amplified fragment varied in size ranges from 100 bp to 1.5 kb. The dendrogram result of polymorphic band showed similarity between the organisms as exhibited by 18 strains (Figure 3). The strain DS-1-20 is closely related to the cluster of DS-1-18, TS-4-12, DS-1-16 and DS-1-26. The strain AS-1-4 shows similarity to cluster containing TS-1-6 and TS-4-23, the former is closely related to the cluster formed by TS-3-27, DJ-1-46 and DS-2-9. The strains DJ-1-10 and TS-3-15 are closely related to each other and distantly related to a cluster formed by AS-1-2 and DJ-1-24, the latter two are related to a cluster formed by DJ-1-22 and DJ-1-3. AS-1-1 strain could not produce polymorphism and hence cannot relate to the cluster (Figure 3).
The genus Burkholderia comprises of 19 species, which includes soil and rhizosphere bacteria as well as plant and human pathogens (Bevivino et al., 1998; Achouak et al., 1999; Zhang et al., 2000; Balandreau et al., 2001). The aerobic, rod-shaped, endospore producing genus Bacillus is a systematically diverse taxon (Claus and Berkeley, 1986). Gene sequence analyses (16SrRNA) have identified at least 10 phylogenetic groups in the genus Bacillus (Shida et al., 1997a). Bacillus cereus AR156 having PGPR activities induces systemic resistance in A. thaliana by simultaneously activating salicylate- and jasmonate/ ethylene-dependent signaling pathways which has been established (Niu et al., 2011). B. cepacia is recognized for its abilities, to promote maize growth (Bevivino et al., 1998), to enhance crop yields (Chiarini et al., 1998), and to suppress many soilborne plant pathogens (Bevivino et al., 1998; Hebbar et al., 1998; McLoughlin et al., 1992), as well as to degrade diverse pesticides (Daubaras et al., 1996; Mueller et al., 1997).
The genus Stenotrophomonas comprises of about eight species. Strains of the most common species, Stenotrophomonas maltophilia, have a function that includes beneficial effects of plant growth (Ryan et al., 2009). S. maltophilia is an ubiquitous, aerobic, non-fermentative and Gram-negative bacillus that is closely related to the Pseudomonas species (Calza et al., 2003). The genus Stenotrophomonas has pathogenic effect and they are resistant to certain antibiotics and susceptible to Chlorampenicol which we have already investigated in our previous study. Nahi et al. (2016) studied the effect of herbicide on nitrogenase and N2 fixing capacity of Stenotrophomonas maltophilia (Sb 16). Bacteria of the genus Azospirillum (α-subclass of Proteobacteria) are known as plant growth promoting rhizobacteria (Okon, 1994. They were isolated from the rhizosphere of many grasses and cereals all over the world, in tropical as well as in temperate climates (Patriquin et al., 1983). Due to cell shape, growth behavior and habitat within grass roots, genus Herbaspirillum were previously thought to be a new Azospirillum species. However, RNA-RNA hybridization experiments reveal no relationship with Azospirillum spp or Aquaspirillum itersonii (Falk et al., 1986). Herbaspirillum seropedicae, Herbaspirillum frisingense and Herbaspirillum lusitanumable are reported to fix nitrogen (Baldani et al., 1986; Kirchhof et al., 2001; Valverde et al., 2003). The endophytic Herbaspirillum sp WT00C isolated from the tea plant, seems to have a potential ability to promote tea-plant rooting and budding due to its capability of producing indole-3-acetic acid (IAA), ammonia and siderophores (Zhan et al., 2016). Bacterial species of the genus Acinetobacter are ubiquitous in nature (Bergogne-Berezin and Towner, 1996).
In recent years, members of the genus Acinetobacter have been isolated from the rhizo- sphere of different plants (Kuklinsky-Sobral et al., 2004; Roberts et al., 2005; Nakayama et al., 2007; Li et al., 2008). In India, A. indicus was described for the first time in soil samples collected from hexachlorocyclohexane dump sites (Malhotra et al., 2012). Strains belonging to the genus Acinetobacter, and their plant growth-promoting properties have been reported in the literature (Sachdeva et al., 2010). The presence of different species of Acinetobacter was worked in the rhizosphere of three agricultural wheat fields of Pune, India. The genetic diversity of Acinetobacter species using metagenomics study in the wheat rhizosphere was assessed by denaturing gradient gel electrophoresis (DGGE) of 16 SrRNA genes PCR products. Plant growth-promoting traits such as nitrogen fixation, siderophore production and mineral solubilization were reported in in vitro culture of Acinetobacter isolates (Sachdeva et al., 2010). From the perusal of literature it has been revealed that, in India no work has been done with Acinetobacter sp in tea field soil for their study related to biofertiliser or PGPR.
Auman et al. (2001) reported nitrogenous and utilize N2 as a nitrogen source by some methane-oxidizing bacteria (methanotrophs). There are two types of methanotrophs - type I and type II. Type II methanotrophs and members of the type I genus Methylococcushave been shown to be capable of nitrogen fixation, while type I methanotrophs are not (Dedysh et al., 2000; Murrell and Dalton, 1983; Oakley and Murell, 1988). The genus Ralstonia established in 1995 by Yabuuchi et al. (1995) accommodate species previously known as Alcaligeneseutrophus, Pseudomonas solanacearum and Pseudomonas pickettii. Ralstonia eutrophaisolated from sludge, soil and R. basilensis from waste-water (Steinle et al., 1998). Chen et al. (2001) isolated several strains of Ralstonia from Mimosa as a symbiont nitrogen fixer, the most promising one is Ralstonia taiwanensis, cells are Gram negative, non spore forming rod shaped and mean cell size which ranges from 0.5 to 0.7 m width and 0.8 to 2.0 m in length (Chen et al., 2001).
Gulati et al. (2011) reported the presence of Gram-negative nitrogen fixing bacteria of α-Proteobacteria genera Brevundimonas, Rhizobium, and Mesorhizobium; γ-Proteobacteria genera Pseudomonas and Stenotrophomonas; and β-Proteobacteria genera Azospira, Burkholderia, Delftia, Herbaspirillum and Ralstonia associated with the tea roots of Kangra Valley of Himachal Pradesh. The isolated bacterial strain identified as Burkholderiasp, Stenotrophomonas maltophila, Herbaspirillum sp, Acinetobacter johnsonii, Methylobacter, SP-T-20, and Bacillus cereus, Azospirillum sp depicts the N2 fixing as well as PGPR activities as evident from homology searching can be used as potent bioferiliser for organic and conventional tea gardens especially in North Bengal. The present investigation will suggest an insight to the tea growers of North Bengal and researchers as readily established “Bio accelerant” or” Bio fertiliser”.
Since tea is a non-leguminous plant, the search for free living N2 fixing soil bacteria in tea growing areas is gaining momentum day by day. Few good strains have been identified to be used as a potential N2 fixer in tea field. The isolated bacterial strain identified as a member of the genus Burkholderia sp, Stenotrophomonas maltophila, Herbaspirillum sp, Acinetobacter johnsonii, Methylobacter, SP-T-20, and Bacillus cereus, Azospirillum sp can be the right candidates as potent bioferiliser for organic and conventional tea gardens of North Bengal, India. Hence, it is evident from the homology searching that our isolated strain would be ascribed as a member of the respective genus until and unless DNA-DNA hybridization and other biochemical parameter have been tested. The study reveals a thorough investigation regarding the molecular identification of free-living N2 fixing bacteria; however, their field application is still needed in further study.
The authors are grateful to Secretary of Oriental Institute of Science and Technology for making use of their facility to carry out the research. Authors are also thankful to Dr. Anindya Sundar Panja of BIMS for his technical assistance.
The authors have not declared any conflict of interests.
REFERENCES
|
Achouak W, Christen, Barakat M, Martel M, Heulin T (1999). Burkholderia caribensis sp. nov., and exopolysaccharide-producing bacterium isolated from vertisol microaggregates in Martinique. International Journal of Systematic Bacteriology 49:787-794.
Crossref
|
|
|
|
Auman A, Speake CC, Lidstrom ME (2001). nifH sequences and N fixation in type I and type II methanotrophs. Applied and Environmental Microbiology 67(9):4009-4016.
Crossref
|
|
|
|
|
Bal H, Das S, Dangar TK, Adhya TK (2013). ACC deaminase and IAA producing growth promoting bacteria from the rhizosphere soil of tropical rice plants. Journal of Basic Microbiology 53: 972-984.
Crossref
|
|
|
|
|
Balachandar D, Raja P, Sundaram SP (2008). Genetic and metabolic diversity of pink-pigmented facultative methylotrophs in phyllosphere of tropical plants. Brazilian Journal of Microbiology 39(1):68-73.
Crossref
|
|
|
|
|
Balandreau J, Viallard V, Cournoyer B, Coenye T, Laevens S, Vandamme P. (2001). Burkholderia cepacia genomovar III is a common plant-associated bacterium. Applied and Environmental Microbiology 67:982-985.
Crossref
|
|
|
|
|
Baldani JI, Baldani VLD, Seldin L, Dobereiner J (1986). Characterization of Herbaspirillum seropedicae gen. Nov., sp. Nov., a root-associated N-fixing bacterium. International Journal of Systematic Bacteriology 36(1):86-93.
Crossref
|
|
|
|
|
Bergogne-Berezin E, Towner KJ (1996). Acinetobacter spp. as nosocomial pathogens: microbiological, clinical, and epidemiological features. Clinical Microbiology Reviews 9:148-165.
|
|
|
|
|
Bevivino A, Sarrocco S, Dalmastri C, Tabacchioni S, Cantale C, Chiarini L (1998). Characterization of a free-living maize-rhizosphere population of Burkholderia cepacia: effect of seed treatment on disease suppression and growth promotion of maize. FEMS Microbiology Ecology 27:225-237.
Crossref
|
|
|
|
|
Bhaduri J, Kundu P, Roy SK (2018). Morphological and biochemical valuation of free living N2 fixing tea rhizospheric and tea soil bacteria of north Bengal tea gardens. Asian Journal of Microbiology, Biotechnology and Environmental Sciences 20(1):301-9.
|
|
|
|
|
Bhattacharyya PN, Jha DK (2012). Plant growth-promoting rhizobacteria (PGPR): emergence in agriculture. World Journal of Microbiology and Biotechnology 28:1327-1350.
Crossref
|
|
|
|
|
Calza L, Manfredi R, Chiodo F (2003). Stenotrophomonas (Xanthomonas) maltophilia as an emerging opportunistic pathogen in association with HIV infection: a 10-year surveillance study. Infection 31:155.
|
|
|
|
|
Chen WM, Laevens S, Lee TM, Coenye T, Vos PD (2001).Ralstonia taiwanensis sp. nov., isolated from root nodules of Mimosa species and sputum of a cystic fibrosis patient. International Journal of Systematic and Evolutionary Microbiology 51:1729-1735.
Crossref
|
|
|
|
|
Chiarini L, Bevivino A, Tabacchioni S, Dalmastri C (1998) .Inoculation of Burkholderia cepacia, Pseudomonas fluorescens and Enterobacter sp. on Sorghum bicolor: root colonization and plant growth promotion of dual strain inocula. Soil Biology and Biochemistry 30:81-87.
Crossref
|
|
|
|
|
Claus D, Berkeley RCW (1986) .Genus Bacillus Cohn 1872, In: Sneath, P.H.A., Mair, N.S., Sharpe, M.E. and Holt. J.G., Eds., Bergey's Manual of Systematic Bac-teriology, The Williams & Wilkins Co., Baltimore 2:1105-1139.
|
|
|
|
|
Compant S, Clement C, Sessitsch A (2010). Plant growth promoting bacteria in the rhizo- and endosphere of plants: their role, colonization, mechanisms involved and prospects for utilization. Soil Biology and Biochemistry 42: 669-678.
Crossref
|
|
|
|
|
Daubaras DL, Danganan CE, Hübner A, Ye RW, Hendrickson W, Chakrabarty A M (1996) .Biodegradation of 2, 4, 5-trichlorophenoxyacetic acid by Burkholderia cepacia strain AC1100: evolutionary insight. Gene 179:1-8.
Crossref
|
|
|
|
|
Dedysh SN, Liesack WVN, Khmelinina NE, Suzina YA, Trotsenko J D, Semrau AM et al., 2000) Methylocella palustris gen. nov., sp. nov., a new methane-oxidizing acidophilic bacterium from peat bogs, representing a novel subtype of serine-pathway methanotrophs. International Journal of Systematic and Evolutionary Microbiology 50:955-969.
Crossref
|
|
|
|
|
El-Fiki A (2006). Genetic diversity in rhizobia determined by random amplified polymorphic DNA Analysis. Journal of Agriculture and Social Sciences 2(1):1-4.
|
|
|
|
|
Falk EC, Johnson JL, Baldani VLD, J Döbereiner, Krieg NR (1986). Deoxyribonucleic and ribonucleic acid homology studies of the genera Azospirillum and Conglomeromonas. International Journal of Systematic Bacteriology 36:80-85.
Crossref
|
|
|
|
|
Fouzia A, Allaoua S, Hafsa CS, Mostefa G (2015). Plant growth promoting and antagonistic traits of indigenous fluorescent Pseudomonas spp. Isolated from wheat rhizosphere and A. Halimus Endosphere. European Scientific Journal 11(24):129-148.
|
|
|
|
|
Glick BR, Bashan Y (1997). Genetic manipulation of plant growth promoting bacteria to enhance biocontrol of fungal phytopathogens. Biotechnology Advances 15:353-378.
Crossref
|
|
|
|
|
Gomes LH, Duarte KMR, Andrino FG, Tavares FCA (2000). A simple method for DNA isolation from Xanthomonas spp. Scientia Agricola 57(3):553-555.
Crossref
|
|
|
|
|
Gulati A, Sood S, Rahi P, Thakur R, Chauhan S, Chawla I nee Chadha (2011). Diversity analysis of diazotrophic bacteria associated with the roots of tea (Camellia sinensis (L.) O. Kuntze). Journal of Microbiology and Biotechnology 21(6):545-555.
|
|
|
|
|
Hayat R, Ali S, Amara U, Khalid R, Ahmed I (2010).Soil beneficial bacteria and their role in plant growth promotion: a review. Annals of Microbiology 60:579-598.
Crossref
|
|
|
|
|
Hebbar KP, Martel MH, Heflin T (1998). Suppression of pre- and postemergence damping-off in corn by Burkholderia cepacia. European Journal of Plant Pathology 104:29-36.
Crossref
|
|
|
|
|
Hugenholtz P, Goebel BM, Pace NR (1998). Impact of culture- independent studies on the emerging phylogenetic view of bacterial diversity. Journal of bacteriology 180: 4765-4774.
|
|
|
|
|
Islam MR, Sultana T, Joe MM, Yim W, Cho J C SA T (2013). Nitrogen-fixing bacteria with multiple plant growth-promoting activities enhance growth of tomato and red pepper. Journal of Basic Microbiology 53:1004-1015.
Crossref
|
|
|
|
|
Kirchhof G, Eckert B, Stoffels M, Baldani JI, Reis VM, Hartmann A (2001). Herbaspirillum f risingense sp.Nov., a new N-fixing bacterial species that occurs in C4-fibre plants. International Journal of Systematic and Evolutionary Microbiology 51(1):157-168.
Crossref
|
|
|
|
|
Kuklinsky-Sobral J, Araújo W, Mendes R, Geraldi I, Pizzirani-Kleiner A, Azevedo J (2004). Isolation and characterization of soybean-associated bacteria and their potential for plant growth promotion. Environmental Microbiology 6:1244-1251.
Crossref
|
|
|
|
|
Lee PY, Costumbrado J, Hsu CY, Kim Yh (2012). Agarose gel electrophoresis for the separation of DNA fragments. Journal of Visualized Experiments (62):3923.
Crossref
|
|
|
|
|
Li JH, Wang ET, Chen WF, Chen WX (2008). Genetic diversity and potential for promotion of plant growth detected in nodule endophytic bacteria of soybean grown in Heilongjiang province of China. Soil Biology and Biochemistry 40:238-246.
Crossref
|
|
|
|
|
Malhotra J, Anand S, Jindal S, Rajagopal R, Lal R (2012). Acinetobacter indicus sp. nov., isolated from a hexachlorocyclohexane dump site. International Journal of Systematic and Evolutionary Microbiology 62:2883-2890.
Crossref
|
|
|
|
|
McLoughlin TJ, Quinn JP, Bettermann A, Booklands R (1992). Pseudomonas cepacia suppression of sunflower wilts fungus and role of antifungal compounds in controlling the disease. Applied and Environmental Microbiology 58:1760-1763.
|
|
|
|
|
Moghaieb REA, Abdelhadi AA, EISadawy H, Allam Nat, Baiome Ba, Soliman MH (2017). Molecular identification and genetic diversity among Photorabdus and Xenorhabdus isolates 3 Biotech 7(1):6.
|
|
|
|
|
Mueller JG, Devereux R, Santavy DL, Lantz SE, Willis SG, Pritchard PH (1997). Phylogenetic and physiological compartment of PAH-degrading bacteria from geographically diverse soils. Antonie Leeuwenhoek 71:329-343.
Crossref
|
|
|
|
|
Murrell JC, H Dalton (1983). N fixation in obligate methanotrophs. Journal of General Microbiology 129:3481-3486.
|
|
|
|
|
Nahi A, Othman R, Omar D, Ebrahimi M (2016). Effects of selected herbicides on growth and nitrogen fixing activity of Stenotrophomonas maltophilia (Sb16). Polish Journal of Microbiology 65(3):377-382.
Crossref
|
|
|
|
|
Nakayama N, Okabe A, Toyota K, Kimura M, Asakawa S (2007). Phylogenetic distribution of bacteria isolated from the floodwater of a Japanese paddy field. Soil Science and Plant Nutrition 52:305-312.
Crossref
|
|
|
|
|
Niu DD, Liu HX, Jiang CH, Wang YP, YaWang Q, Jin HL, Guo JH (2011). The plant growth-promoting rhizobacterium Bacillus cereus AR156 induces systemic resistance in Arabidopsis thaliana by simultaneously activating salicylate- and jasmonate/ethylene-dependent signaling pathways. Molecular Plant Microbe Interaction 24(5):533-542.
Crossref
|
|
|
|
|
Oakley CJ, JC Murrell (1988). nifH genes in the obligate methane oxidizing bacteria. FEMS Microbiology Letters 49:53–57.
Crossref
|
|
|
|
|
Okon Y (1994). Azospirillum/plant associations, CRC Press, Boca Raton, FL. P 175
|
|
|
|
|
Patriquin DG, Döbereiner J, Jain DK (1983). Sites and processes of association between diazotrophs and grasses. Canadian Journal of Microbiology 29:900-915.
Crossref
|
|
|
|
|
Philippot L, Raaijmakers JM, Lemanceau P, Putten WHV (2013). Going back to the roots: the microbial ecology of the rhizosphere. Nature Reviews Microbiology 11:789-799.
Crossref
|
|
|
|
|
Rajsundari K, IIamuruguK, Logeshwaran P (2009). Genetic diversity in rhizobial isolates determined by RAPDs. African Journal of Biotechnology 8(12):2677-2681.
|
|
|
|
|
Roberts DP, Lohrke SM, Meyer SLF, Buyer JS, Bowers JH, Baker CJ et al., (2005). Biocontrol agents applied individually and in combination for suppression of soil borne diseases of cucumber. Crop Protection 24:141-155.
Crossref
|
|
|
|
|
Richardson AE, Barea JM, McNeill AM, Prigent-Combaret C (2009). Acquisition of phosphorus and nitrogen in the rhizosphere and plant growth promotion by microorganisms. Plant Soil 321:305-339.
Crossref
|
|
|
|
|
Ryan RP, Monchy S, Cardinale M, Taghavi S, Crossman L, Avison MB, Berg G, van der LelieD, Dow JM (2009). The versatility and adaptation of bacteria from the genus Stenotrophomonas. Nature Reviews Microbiology 7:514-525.
Crossref
|
|
|
|
|
Sachdeva D, Nema P, Dhakephalkar P, Zinjarde S, Chopade B (2010). Assessment of 16Sr RNA gene-based phylogenetic diversity and promising growth of the plant-promoting traits of Acinetobacter community from the zone adjacent to root of wheat. Microbiological Research 165:627-638.
Crossref
|
|
|
|
|
Sharma U, Paliyal SS, Sharma SP, Sharma GD (2014). Effects of continuous use of chemical fertilizers and manure on soil fertility and productivity of maize-wheat under rainfed conditions of the Western Himalayas. Communications in Soil Science and Plant Analysis 45(20):2647-2659.
Crossref
|
|
|
|
|
Shida O, Takagi H, Kadowaki K, Nakamura LK, Komagata K (1997a). Transfer of Bacillus alginolyticus, Bacillus chondroitinus, Bacillus curdlanolyticus, Bacillus glucanolyticus, Bacillus kobensis, and Bacillus thiaminolyticus to the genus Paenibasillus and emended description of the genus Paenibacillus. International Journal of Systematic Bacteriology 47:289-298.
Crossref
|
|
|
|
|
Steinle P, Stucki G, Stettler Hanselmann K W (1998). Aerobic mineralization of 2, 6-dichlorophenol by Ralstonia sp. isolate RK1. Applied and Environmental Microbiology 64:2566-2571.
|
|
|
|
|
Tamura K, Nei M, Kumar S (2004). Prospects for inferring very large phylogenies by using the neighbor-joining method. Proceedings of the National Academy of Sciences of the United States of America 101:11030-11035.
Crossref
|
|
|
|
|
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011). MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28(10):2731-2739.
Crossref
|
|
|
|
|
Teaumroong N, Boonkerd N (1998). Detection of Bradyrhizobium spp. and B. japonicum in Thailand by primer based technology and direct DNA extraction. Plant and Soil 204:127-134.
Crossref
|
|
|
|
|
Valverde A, Velazquez E, Gutierrez C, Cervantes E, Ventosa A, Igual JM (2003). Herbaspirillum lusitanum sp. Nov., a novel N-fixing bacterium associated with root nodules of Phaseolus vulgaris. International Journal of Systematic Bacteriology 53(6):1979-1983.
Crossref
|
|
|
|
|
Vejan P, Abdullah R, Khadiran T, Ismail S, Boyce AN (2016). Role of plant growth promoting rhizobacteria in agricultural sustainability-A Review Molecules 21:573:1-17.
|
|
|
|
|
Vessey JK (2003). Plant growth promoting rhizobacteria as biofertilizers. Plant Soil 255:571-586.
Crossref
|
|
|
|
|
Yabuuchi E, Kosako Y, Yano I, Hotta H, Nishiuchi Y (1995). Transfer of two Burkholderia and an Alcaligenes species to Ralstonia gen. Nov.: Proposal of Ralstonia pickettii (Ralston, Palleroni and Doudoroff 1973) comb. Nov., Ralstonia solanacearum (Smith 1896) comb. Nov. and Ralstonia eutropha (Davis 1969) comb. Nov. Microbiology and Immunology 39:897-904.
Crossref
|
|
|
|
|
Zhan G, Cheng W, Liu W, Li Y, Ding K, Rao H, Wu W, Wang X (2016). Infection, colonisation and growth promoting effects of tea (Camellia sinensis L.) by the endophytic bacterium Herbaspirillum sp. WT00C. African Journal of Agricultural Research 11(3):130-138.
Crossref
|
|
|
|
|
Zhang H, Hanada S, Shigematsu T, Shibuya K, Kamagata Y,Kanagawa T, Kurane R (2000). Burkholderia kururiensis sp. nov., a trichloroethylene (TCE)-degrading bacterium isolated from an aquifer polluted with TCE. International Journal of Systematic and Evolutionary Microbiology 50:743-749.
Crossref
|
|
