African Journal of
Microbiology Research

  • Abbreviation: Afr. J. Microbiol. Res.
  • Language: English
  • ISSN: 1996-0808
  • DOI: 10.5897/AJMR
  • Start Year: 2007
  • Published Articles: 5241

Full Length Research Paper

Evaluation of a real-time PCR assay for the detection of the Klebsiella pneumoniae carbapenemase gene (blaKPC) in enterobacteriaceae isolates from clinical samples in Menoufia University hospitals, Egypt

Amira Abdelkader Al Hindi
  • Amira Abdelkader Al Hindi
  • Department of Clinical Pathology (Microbiology), Faculty of Medicine, Menoufia University, Egypt.
  • Search for this author on:
  • Google Scholar
Abeer Hamdy El Shalakany
  • Abeer Hamdy El Shalakany
  • Department of Clinical Pathology (Microbiology), Faculty of Medicine, Menoufia University, Egypt.
  • Search for this author on:
  • Google Scholar


  •  Received: 22 June 2016
  •  Accepted: 23 August 2016
  •  Published: 14 September 2016

 ABSTRACT

The aim of our work is to study and evaluate a rapid method for detection of Klebsiella pneumonia carbapenemases genes (blaKPC) in enterobacteriaceae isolates from clinical samples by using real time PCR and comparison of this method with ordinary phenotypic methods. Outbreaks of carbapenem‐resistant enterobacteriaceae (CRE), primarily K. pneumoniae, have been reported recently in several regions worldwide. The production of carbapenemases especially K. pneumoniae carbapenemase (KPC) is the most important mechanism of enzymatic resistance in enterobacteriaceae. One hundred and fifty clinical isolates from different departments of Menoufia university hospitals were tested by both disc diffusion method (Imipenem 10 μg,  Meropenem 10 μg and Ertapenem 10 μg), and imipenem E-test for minimum inhibitory concentration (MIC) then analyzed according to cut off-points of CLSI 2014 guideline. Then all the one hundred fifty clinical isolates were tested for the presence of a blaKPC gene by real time PCR. We found Eighty three   (83) isolates (55.3%) from 150 were resistant to one or more carbapenems by disk diffusion method, and 88 isolates (58.7%) were resistant by E test while 91 isolates (60.6%) were positive for the presence of KPC gene by real time PCR. There was significant difference between disk diffusion method and real-time PCR (P < 0.001) and E test and real-time PCR (P < 0.001) regarding carbapenem resistance. The highest percent of enterobacteriaceae isolates having KPC gene were among K .pneumoniae (46.1%). KPC positive cases were mainly (74.1%) from urology department. About (97.8%) blaKPC PCR positive cases had been exposed to invasive procedures such as mechanical ventilation (P < 0.001), and (95.6%) blaKPC PCR positive cases had been from hospital acquired infections (P < 0.001). There was a history of antimicrobial intake in 70.3% of cases infected with KPC PCR positive isolates. blaKPC PCR has sensitivity ,specificity, negative predictive value,  and diagnostic accuracy (99, 87, 98 and 93%), respectively .

 

Key words: carbapenem‐resistant enterobacteriaceae (CRE), real time PCR, blaKPC.


 INTRODUCTION

Carbapenems are highly efficacious drugs for treating infections with extended-spectrum β-lactamase–producing gram-negative bacteria. Previously, resistance to carbapenems has been rare; however, the emergence of transmissible carbapenem resistance is now a growing concern. (Raghunathan et al., 2011).
 
An increasingly common mechanism of carbapenem resistance is the class-A, Klebsiella pneumoniae carbapenemase (KPC). KPCs have been reported in K pneumoniae and in Klebsiella oxytoca, Pseudomonas aeruginosa, Escherichia coli, Proteus mirabilis, Citrobacter freundii, Enterobacter spp, Serratia spp, and Salmonella spp. (Villegas et al., 2006).
 
The blaKPC genes that encode KPCs are present on transferable plasmids and are flanked by transposable elements, thus allowing for the gene to move from plasmid to the bacterial chromosome and back (Bratu et al., 2005).
 
 This potential to disseminate resistance has been demonstrated in several reported outbreaks with high mortality rates (Raghunathan et al., 2011).
 
Given the limited therapeutic options available, the accurate and timely detection of KPC-producing enterobacteriaceae is vital in order to control their spread (Nordmann et al., 2009).
 
The mechanisms of resistance to carbapenems may be related to the combination of decrease in bacterial outer membrane permeability, increasing production of Extended-Spectrum Beta-Lactamases (ESBLs), AmpC beta-lactamases and expression of betalactamases like Carbapenemases. The production of carbapenemases especially KPC is the most important mechanism of enzymatic resistance in isolated Enterobacteriaceae such as K. pneumoniae (Nordmann et al., 2012).
 
The detection of KPC-producing bacteria can be challenging because of heterogeneous expression of β-lactam resistance. Automated and agar diffusion methods of susceptibility testing show some inconsistencies in reliably detecting KPC-mediated resistance, and this is influenced by the carbapenem that is used for testing (Francis  et al., 2012; Fallah et al., 2013).
 
To address these issues, confirmatory tests such as several polymerase chain reaction (PCR)-based assays have been developed to detect KPC-mediated carbapenem resistance. Real-time PCR has been employed in the rapid detection of colonization/infection with KPC-producing Enterobacteriaceae in various types of samples and clinical isolates.
 
These assays have demonstrated good sensitivity and specificity with favorable positive and negative predictive values (Schechner et al., 2009).
 
PATIENTS
 
This study was conducted on clinical isolates of enterobacteriaceae that were isolated from samples sent to microbiology laboratory of Menoufia University Hospitals, from July 2013 to September 2014.
 
Subjects
 
One hundred fifty clinical isolates from different departments of Menoufia university hospitals were tested. During the study period, all strains of enterobacteriaceae isolated were stored on broth glycerol at-70ºC for subsequent PCR analysis.


 METHODS

Enterobacteriacae isolates were identified by conventional methods such as culture characteristics and biochemical reactions (Colle et al., 1996). Triple sugar iron agar (TSI), lysine iron agar (LIA), motility indole ornithine (MIO), Simmons citrate agar and urea agar base (Oxoid England) plus identification by API 20E (https://apiweb.biomerieux.com).
 
Susceptibility testing
 
0.5 McFarland turbidity suspension for each isolate was used to inoculate on Mueller-Hinton agar plates (Oxoid England).
 
Disk diffusion
 
By using imipenem, meropenem and ertapenem disk diffusion. Results were categorized as sensitive, intermediate and resistant as according to Clinical Laboratory Standard Institute (CLSI) guidelines 2014 (Imipenem 10 μg: S: ≤1, I: 2, R: ≥4), (Meropenem: 10 μg: S: ≤1, I: 2, R: ≥4), (Ertapenem: 10 μg: S: ≤0.5, I: 1, R: >2).
 
E-Test for imipenem
 
MIC for imipenem was determined using E-test (bioMérieux) and results were categorized as sensitive, intermediate and resistant as per Clinical Laboratory Standard Institute (CLSI) guidelines 2014 (S ≤1, I: 2, R ≥ 4) (CLSI, 2014)
 
Genotypic detection of KPC
 
All clinical isolates of enterobacteriaceae were tested for the presence of a blaKPC gene by real time PCR:
 
DNA extraction
 
DNA extraction using the GeneJET Genomic DNA Purification Kit (Thermo Scientific K0721, Fermentas, UE), using Gram-negative bacteria genomic DNA purification protocol.
 
Sample preparation
 
After an overnight pure growth on MacConkey, 2 to 3 of bacterial colonies were inoculated into 1 ml of nutrient broth water then overnight incubation.
 
 
Real-time PCR amplification and detection
 
Real-time PCR was performed on Spartan RX CYP2 C 19 instrument using Syber Green with the following primers (Raghunathan et al., 2011): Forward primer, 5'- ATGTCACTGTATCGCCGTC -3' (80-250 nM final concentration), Reverse primer, 5'- CTCAGTGCTCTACAGAAAACC -3' (80-250 nM final concentration) and 5x HOTFIREPol®EvaGreen®qPCR Mix Plus (no ROX) –Solis biodyne– Cat 08-25-00001, a reaction mix was prepared according to Table 1.
 
 
Method
 
1. The reaction mix was mixed thoroughly, and appropriate volume was dispensed into PCR tubes or plates.
2. Template DNA was added (0.01 to 10 ng/μl) to the individual PCR tubes or wells containing the reaction mix.
3. Real-time instrument Spartan was programmed according to the
following cycling conditions: 95C for 15 min, followed  by  40  cycles
of 95°C for 15 s, 57°C for 20 s, and 72°C for 20 s. And finally dissociation at 95°C for 30 min.


 RESULTS

Eighty three (83) isolates (55.3%) from 150 were resistant to one or more carbapenems by disk diffusion method and sixty seven were sensitive (Table 2).
 
This table shows that 88 isolates (58.7%) from all enterobacteriacea isolates (150) were resistant by E test and 62 (41.3%) were sensitive (Table 3). This table shows that 91 isolates (60.6%) from all enterobactericea isolates (150) were positive for the presence of KPC gene by real-time PCR and 59 (39.4%) were negative (Table 4). In this study, the melting temperature was 81.9°C (Figure 3), the positive cases for the presence of blaKPC gene show melting peaks that express fluorescence exceeding the threshold line (Figure 1) while negative cases express fluorescence that does not exceed the threshold line (Figure 2).
 
 
 
This table shows that from 83 carbapenem resistant isolates by disk diffusion, 82 were blaKPC PCR positive and from 67 carbapenem sensitive isolates, 9 were blaKPC PCR positive, and there was highly significant difference(p<0.001) between two methods  (Table 5).
 
This table shows that from (88) resistant isolates by E-test,  82 (93.2%) were  blaKPC PCR positive cases from 62 carbapenem sensitive isolates, 9 were blaKPC PCR positive, and there was highly significant difference (p<0.001) between two methods (Table 6).
 
Real time PCR detected 82 (98.8%) of  carbapenem resistant isolates by DDT, thus the sensitivity of the PCR was 99%, specificity was 87% and diagnostic accuracy was 93%, all in relation to DDT as gold standard test  (Table 7).
 
Real time PCR detected 82 (93.2%) of E -test resistant isolates, thus the sensitivity of the PCR was 93.2%, specificity was 85.5% and diagnostic accuracy was 90%, all in relation to E- test as gold standard test (Table 8). As regarding evaluation of the performance of the real-time PCR using disk diffusion susceptibility results, there were 2 cases which were negative for blaKPC by PCR and in the same time were resistant by disk diffusion (Table 9).
 
 
The highest percent of enterobacteriaceae isolates having KPC gene were  among  K .pneumoniae  (46.1%) while the lowest percent were among proteus (2.2%) (Table 10) KPC positive cases were mainly (74.1%) from urology department which represented (21.9%) of their isolates, followed by ICU (57.6%) which represented (37.4%) of their isolates (Table 11). About (97.8%) blaKPC PCR positive cases had been exposed to invasive procedures such as mechanical ventilation, urinary catheterization, CVL and cannula insertion (Table 12). About (95.6%) blaKPC PCR positive cases had been isolated from cases with hospital acquired infections (Table 13).There was a history of antimicrobial intake in 70.3% of cases infected with KPC PCR positive isolates (Table 14).
 
 


 DISCUSSION

The emergence and rapid dissemination of carbapenem-resistant enterobacteriaceae (CRE) worldwide is a cause for concern. Treatment options for infections due to these organisms are extremely limited and effective therapy may be delayed whilst microbiology laboratory confirmatory results are awaited (Burns and Schaffer, 2011).
 
The rapid detection of KPC-producing enterobacteriaceae is of great importance since these organisms have the potential to spread rapidly in hospital environments and cause nosocomial infections with high
mortality rates (Samra et al., 2007; Tibbetts et al., 2008; Burns and Schaffer, 2011). The aim of our study is to study a rapid method for detection of K. pneumoniae carbapenemase genes (blaKPC) in enterobacteriaceae isolates in clinical samples by using real time PCR and comparing phenotypic with genotypic results.
 
In our study 83 (55.3%) of 150 samples had reduced susceptibility to one or more carbapenems. This is similar to a study conducted by Landman et al. (2005) in New York, where (61.5%) of lactose fermenting gram-negative bacilli were imipenem resistant by disc diffusion. In a study conducted by Patel et al. (2008) in Europe and Hindiyeh et al. (2008) in Israel, the carbapenem-resistant K. pneumoniae by disc diffusion was 26 and 25.1%, respectively.
 
 
 
On the other hand, resistance reported by Marschall et al. (2009) was 2.9%, also in the Faculty of Medicine Vajira Hospital in University of Bangkok, Metropolis, the incidence of CRE was 0.13% and the presence of the resistance was an important public health problem (Phumisantiphong, 2011).
 
For certain reasons there is a wide variability in prevalence of CRE. The possible factors could be different geographical locations, variable proficiency levels of microbiology trained technical staff, different antibiotic cut offs being used, different guidelines being followed and different techniques being used for CRE detection.
 
In several western studies, prevalence of CRE was less than that found in our study. The higher prevalence compared to western countries can be explained by the fact that western countries had strict infection control policies and practices, efficient and effective antibiotic audit systems, shorter average hospital stay, better nursing barriers and other important health care measures that are known to substantially decrease the chances of acquisition and spread of CRE
 
There are several factors that make detection of CRE by susceptibility testing is challenging and make carbapenem-resistant bacteria incorrectly identified as carbapenem susceptible, resulting in inappropriate selection of therapy. One of these factors may be the heterogeneous expression of β-lactam resistance (Chen et al., 2011) or the low level of resistance that cannot be detected by ordinary susceptibility tests Thomson (2010).
 
In addition, Meropenem and imipenem susceptibility demonstrated poor sensitivity for methods other than BMD (broth microdilution). However, the specificity of meropenem and imipenem susceptibility testing was higher than that for ertapenem susceptibility testing regardless of test method (Benenson et al., 2011).
 
The ertapenem disk-diffusion test has been shown to be a reliable screening method for KPC-mediated resistance (Bratu et al., 2005). Therefore, results for culture-based susceptibility to ertapenem are often used for determining carbapenem resistance in routine clinical microbiology laboratories. However, resistance to ertapenem alone is not a marker for KPC expression; it has been shown that most ertapenem resistance is related to factors such as an extended-spectrum β-lactamase (ESBL) or AmpC production in association with outer membrane porin mutations (Francis  et al., 2012).
 
In order to overcome such shortcomings when treating infections caused by enterobacteriaceae, the Clinical and Laboratory Standards Institute (CLSI) has recently lowered the susceptibility breakpoints for meropenem, imipenem, ertapenem and doripenm (Chen et al., 2011). Also, the presence of scattered inner colonies along the inhibition zone can lead to perceived increased resistance. The presence of scattered  colonies  may  be due to decreased expression of the porin channel OmpK36, which has been found in isolates expressing blaKPC (Bulik et al., 2010).
 
Our study showed that the resistant isolates to imipenem by E-test were 88 out of 150 (58.7%). While in a study conducted by Gupta et al. (2011) in New York City, carbapenem resistance by E-Test was reported in (10.8%) of isolates that were associated with certain device-related infections.
 
Girlich et al. (2013) found on 133 well-characterized enterobacterial isolates, KPC and meropenem-containing MP/MPI Etest had high sensitivity (>92 %) and specificity (>97 %).
 
Although we included the  E test method in our study, but determining resistance and susceptibility for imipenem with E test was difficult because of the colonies  that were present within the zones of inhibition and make lack of consensus on reading  E test  method.
 
In Rapp and Urban (2012), most KPC-producing isolates had a carbapenem MIC ≥ 2 μg/ml, but some have been reported to be susceptible to carbapenems. The reason for this discrepancy is that full resistance to carbapenems usually requires the presence of a second mechanism of resistance such as a defect in the permeability of outer membrane. Detection of blaKPC genes by PCR has been proposed as the gold standard for detection of KPC-bearing organisms. To date, several PCR based detection methods have been described , including two real-time PCR assays, as well as a method that uses PCR in conjunction with electrospray ionization mass spectrometry (PCR/ESI-MS) (Chen et al., 2011).
 
Currently DNA sequencing is the definitive method for identification of blaKPC gene. However, sequencing is impractical for studies involving large sample sizes, as well as for rapid identification in clinical settings. In contrast, methods such as real-time PCR offer rapid, robust, and cost-efficient alternatives to DNA sequencing for blaKPC gene (Chen et al., 2011).
 
Our study showed that 91 out of 150 (60.6%) had KPC gene by real- time PCR. This result is higher than that from a United State (0.5%) (Deshpande et al.,2006). However, prevalence rates of (KPC-Kp) isolates of >30% have been recorded in the eastern United States (Nordmann et al., 2011). Another study of Brooklyn hospitals reported 38% prevalence of blaKPC (Landman et al., 2007).  In this study, there were 2 cases which were negative for blaKPC by PCR and in the same time were resistant by disk diffusion. These results were not due to inhibition of the PCR reactions because the internal control target was successfully amplified.
 
The negative PCR result with the presence of disk diffusion resistance can be due to presence of eleven types or alleles of KPC gene (KPC1-11) while we used only single primers for detection of blaKPC (Arnold et al., 2012),or It is possible that the carbapenem resistance was due to one of several other mechanisms, including changes  in   outer   membrane   permeability,   ncreased activity of antibiotic efflux systems, or the production of AmpC β-lactamases, ESBLs, or non-KPC carbapenemases (Queenan and Bush, 2007).
 
In addition, it is also possible that the amount of template DNA for these samples was inadequate or that sequence alterations in the bla KPC gene affected the binding of the primers or probes used in the assay (Francis  et al., 2012).
 
One of the disadvantages of PCR is specificity for the particular target sequence, so they cannot be used to monitor the emergence of novel variants (Raghunathan et al., 2011).
 
In this study, out of the 91 blaKPC positive isolates 46.1% were K. pneumonia. These results are in accordance with those from a study of Landman et al. (2007), where (95%) of blaKPC positive isolates were K. pneumoniae. Another study conducted by Qi et al. (2011) shows that all clinical isolates of K. pneumoniae (100%) with carbapenem resistance were confirmed as KPC producers by PCR.
 
This is  different from study done by (Francis et al. (2012), who showed that the most common KPC  positive enterobacteriaceae was Escherichia coli (44.9%), and a study  done by Marschall et al. (2009),where  (37.0%) of isolates were E. coli.
 
K. pneumoniae remains the most prevalent bacterial species carrying KPCs .The rapid global spread of KPC-producing K. pneumoniae is now understood, it is  a largely clonal phenomenon. A specific clone of KPC-producing K. pneumoniae, called ST258, is globally distributed. ST stands for sequence type, and is assigned by multilocus sequence typing, which is a nucleotide sequence-based bacterial typing method where seven genes on the chromosome are sequenced. ST258 predominates among KPC-producing K. pneumoniae in the United States. ST258 as well as ST512, which is closely related to ST258, has been found commonly in Israel and Italy, whereas ST11 and ST437 appear to predominate in China and Brazil, respectively (Doi and Paterson, 2015).
 
These STs are all closely related to ST258 suggesting the presence of a common origin, most likely in the mid-Atlantic United States. On the other hand, plasmids carrying the KPC gene are diverse in structure and often capable of self-transmission to other strains by conjugation (Doi and Paterson, 2015).
 
In addition, the production of carbapenemases especially KPC is the most important mechanism of enzymatic resistance in isolated enterobacteriaceae such as K. pneumoniae. KPCs are encoded by the gene bla-KPC, whose potential for different species and universal spreading is mainly elucidated by its location within a Tn3-type transposon, Tn4401. This transposon is able to inserting into varied plasmids of Gram-negative bacteria. Plasmids carrying bla-KPC are related to resistance factors for other antibiotics, the enzyme has been identified in several other Gram-negative bacilli (Bina  et
al., 2015).
 
Hospital acquired infections (HAI) are defined as infections not present at the time of admission to hospital. Most infections that become clinically evident after 48 h of hospitalization are considered hospital-acquired (Edwards et al., 2008).
 
In our study, we found that 95.6% of KPC PCR positive isolates were from hospital acquired infection cases and this was also statistically highly significant (P < 0.001). This was in accordance with Aggeliki et al. (2012) who reported the recent emergence of carbapenemase-producing enterobacteriaceae strains which represented a major threat for hospitalized patients in Greek hospitals, and also show that duration of hospitalization before bacteremia was the only risk factor for multidrug bloodstream infections.
 
The description of outbreaks indicates that producer strains seem to benefit from selective advantages in hospitals where antimicrobial use is much higher and opportunities for transmission more frequent than in the community (Grundmann et al., 2010). According to Papadimitriou -Olivgeris et al. (2012) there was no patient positive for blaKPC without prior hospitalization or antibiotic use before ICU admission.
 
In our study we found that the high percentage of KPC-producing enterobacteriaceae spp. by PCR was found in patients with history of antibiotic administration (70.3%). This also coincides with Gasink et al. (2009) who found a correlation between the selective pressure of antimicrobial agents and the presence of KPC resistance genes residing on the plasmid.
 
According to Woodford et al. (2010) and Gasink et al. (2009) it was postulated that prior use of an extended-spectrum cephalosporin and ciprofloxacin may be selective for KPC enzymes and also it was reported by Kwak et al. (2005) that the previous use of carbapenems and cephalosporins were identified as independent risk factors for acquisition of carbapenem resistant K.  pneumonia. In rectal and tracheal KPC- K. pneumoniae colonized patients, prolonged antibiotic therapy administered for non KPC-Kp infection predisposes patients to subsequent KPC-Kp ventilator associated pneumonia (VAP). Short prophylaxis of early pneumonia with amoxicillin/clavulanic acid, reducing the need for subsequent antibiotic use, may be associated with reduced risk for KPC-Kp VAP (Sbrana et al., 2016).
 
According to the study of  Tuon et  al. (2012), Fluoroquinolones were an independent risk factor for KPC production, which might be explained by the fact that plasmid-encoded qnr genes, which determine low-level fluoroquinolone resistance, have been identified in the same conjugative K. pneumonia plasmid as CP genes (specifically blaKPC-2 and qnrB4).
 
In our study, we found that (97.8%) of KPC PCR positive isolates had been exposed to invasive procedures such as mechanical ventilation, urinary catheterization, central  venous  line  (CVL)  and  cannula insertion, and this was statistically highly significant (P < 0.001).
 
This is in accordance with Lee (2012) who reported that mechanical ventilation is a risk factor for infection with KPC producing organisms, and Kwak et al. (2005) who reported that catheterization is a risk factor for carbapenem-resistant acquisition.
 
KPC positive cases were mainly from urology department (74.1%) followed by ICU (57.6%). This is similar to that reported by Lee (2012) who showed that KPC positive cases were mainly isolated from patients who had high ICU admission status (72%) this may be due to that most of ICU patients were immunocompromised and may be due to the selective pressure imposed by extensive use of antimicrobials and the potential for patient-to-patient transmission of organisms was greatest.
 
Our study showed that 82 (98.8%) of carbapenem resistant isolates by using disk diffusion method, were blaKPC PCR positive cases. We found that the sensitivity of the PCR was 99%, specificity was 87%, PPV of 90%, NPP of 98% and diagnostic accuracy was 93%, all in relation to DDT as gold standard test.
 
This is similar to Hindiyeh et al. (2011) who reported that real-time PCR assay is sensitive and specific compared with culture-based methods of detecting carbapenem resistance attributable to KPC.
 
Also, Cole et al. (2009) reported that direct detection of blaKPC by PCR shorten the time to identify patients colonized or infected with carbapenem resistant organisms and is more sensitive than culture.


 CONCLUSION

Real time PCR for detection CRE through detection of blaKPC gene in enerobacteriacea, is a sensitive, accurate, and rapid method with a shorter turnaround time than those with culture based protocols. Beside it has high negative predictive value to rule out the resistance to cabapenems.


 CONFLICT OF INTERESTS

The authors have not declared any conflict of interests.



 REFERENCES

Aggeliki EV, Georgia V, Grigorios X, Aris P, Vassiliki C, Fani M, Athanassios T (2012). Imported KPC-Producing Klebsiella pneumoniae Clones in a Greek Hospital: Impact of infection control measures to restrain their dissemination. J. Clin. Microbiol. 50(8):2618-2623.
Crossref
 

Arnold R, Thom K, Sharma S, Phillips M, Johnson K, and Morgan D (2012). Emergence of Klebsiella pneumoniae Carbapenemase (KPC)-Producing Bacteria South. Med. J. 104(1):40-45.
Crossref

  
 

Benenson S, Temper V, Cohen MJ, Schwartz C, Hidalgo-Grass C, Block C (2011).Imipenem Disc for Detection of KPC Carbapenemase-Producing Enterobacteriaceae in Clinical Practice. J. Clin. Microbiol. 49(4):1617-1620.
Crossref

  
 

Bina M , Pournajaf A , Mirkalantari SH , Talebi M , Irajian GH (2015). Detection of the Klebsiella pneumoniae Carbapenemase (KPC) in K. pneumoniae Isolated from the Clinical Samples by the Phenotypic and Genotypic Methods. Summer 10(3):199-205.

  
 

Bratu S, Landman D, Haag R (2005). Rapid spread of carbapenem‐resistant Klebsiella pneumoniae in New York City: a new threat to our antibiotic armamentarium. Arch. Int. Med. 165(12):1430‐1435.
Crossref

  
 

Bulik C, Fauntleroy K, Jenkins S, La Bombardi M, Nicolau D, and Kuti J (2010).Comparison of meropenem MICs and susceptibilities for Carbapenemase‐producing Klebsiella pneumoniae isolates by various testing methods. J. Clin. Microbiol. 48(7):2402-2406.
Crossref

  
 

Burns K and Schaffer K (2011). CRE update issued on laboratory detection and infection control measures. Disease surveillance report of HPSC, Ireland. Epi Insight 12(5):33-47.

  
 

Chen L, Mediavilla JR, Endimiani A, Rosenthal ME, Zhao Y, Bonomo RA, Kreiswirth BN (2011). Multiplex Real-Time PCR Assay for Detection and Classification of Klebsiella pneumoniae Carbapenemase Gene (blaKPC) Variants. J. Clin. Microbiol. 49(2):579-585
Crossref

  
 

Clinical Laboratory Standards Institute (CLSI) (2014). Performance standards for antimicrobial susceptibility testing; 24th informational supplements. CLSI document M100‐S21, Wayne PA.

  
 

Cole JM, Schuetz AN, Hill CE, and Nolte FS (2009). Development and Evaluation of a Real-Time PCR Assay for Detection of Klebsiella pneumonia Carbapenemase Genes. J. Clin. Microbiol. 47(2):322-326.
Crossref

  
 

Collee JG, Miles RS, Watt B (1996). Tests for the identification of bacteria In: Mackie & MacCartney, Practical medical microbiology. 14th edition, ch.7. by Collee JG, Fraser AG, Marmion BP and Simmons A (eds). Churchill Livingstone New York, USA. 1:131-149.

  
 

Deshpande LM, Jones RN, Fritsche TR, Sader HS (2006). Occurrence and characterization of carbapenemase-producing Enterobacteriaceae: Report from the SENTRY antimicrobial surveillance program (2000–2004). Microb. Drug. Resist. 12:223-230.
Crossref

  
 

Doi Y, Paterson DL. (2015). Carbapenemase-Producing Enterobacteriaceae Semin. Respir. Crit. Care Med. 36:74-84.
Crossref

  
 

Edwards JR, Peterson KD, Andrus ML, Dudeck MA, and Pollock DA, Horan TC (2008).National Healthcare Safety Network (NHSN) Report, data summary for 2006 through 2007, issued November 2008. Am. J. Infect. Control. 36(9):609-626.
Crossref

  
 

Fallah F, Hakemi Vala M, Hashemi A, Shams S (2013):Emergence of Novel Plasmid-mediated Beta-lactamase in Klebsiella pneumoniae. Qom. Univ. Med. Sci. J. 6(4):104-116.

  
 

Francis R, Wu F, Della‐Latta P, Shi J, and Whittier S (2012). Rapid detection of Klebsiella pneumoniae carbapenemase genes in Enterobacteriaceae directly from blood culture bottles by Real‐Time PCR. Am. J. Clin. Pathol. 137:627‐632.
Crossref

  
 

Gasink LB, Edelstein PH, Lautenbach E, Synnestvedt M, Fishman NO (2009).Risk factors and clinical impact of Klebsiella pneumoniae carbapenemase-producing K. pneumoniae. Infect. Control Hosp. Epidemiol. 30:1180-1185.
Crossref

  
 

Girlich D, Halimi D, Zambardi G, Nordmann P (2013): Evaluation of Etest® strips for detection of KPC and metallo-carbapenemases in Enterobacteriaceae. Diagn. Microbiol. Infect .Dis. 77(3):200-201.
Crossref

  
 

Grundmann H, Livermore DM, Giske CG, Canton R, Rossolini GM, Campos J, Vatopoulos A, Gniadkowski M, Toth A, Pfeifer Y, Jarlier V, Carmeli Y (2010). The CNSE Working Group. Carbapenem- non -susceptible Enterobacteriaceae in Europe: Conclusions from a meeting of national experts. Euro. Surveill. 15(46):19711.

  
 

Gupta N, Limbago B, Patel J, and Kallen A (2011): Carbapenem‐Resistant Enterobacteriaceae: Epidemiology and Prevention Clin. Infect. Diseases 53(1):60‐67.

  
 

Hindiyeh M, Smollan G, Grossman Z, Ram D, Robinov J, Belausov N, Ben-David D, Tal I, Davidson Y, Shamiss A, Mendelson E (2011). Rapid detection of blaKPC carbapenemase genes by internally controlled real-time PCR assay using bactec blood culture bottles. J. Clinical Microbiol. 49(7):2480-2484.
Crossref

  
 

Hindiyeh M, Smollen G, Grossman Z, Ram D, Davidson Y, Mileguir F, Vax M, David D, Tal I, Rahav G, Shamiss A, Mendelson E, and Keller N (2008). Rapid Detection of blaKPC Carbapenemase Genes by Real‐ Time PCR. J. Clin. Microbiol. 46(9):2879‐2883.
Crossref

  
 

Kwak YG, Choi SH, Choo EJ, Chung JW, Jeong JY, Kim NJ, Woo JH, Ryu J, Kim YS (2005). Risk factors for the acquisition of carbapenem-resistant Klebsiella pneumoniae among hospitalized patients. Microbial Drug Resistance 11(2):165-169.
Crossref

  
 

Landman D, Bratu S, Kochar S, Panwar M, Trehan M, Doymaz M, and Quale J (2007). Evolution of antimicrobial resistance, among Pseudomonas aeruginos, Acinetobacter baumannii and Klebsiella pneumoniae in Brooklyn. J. Antimicrob. Chemother. 60:78‐82.
Crossref

  
 

Landman D, Salvani J, Bratu S, Quale J (2005). Evaluation of techniques for detection of carbapenem‐resistant Klebsiella pneumoniae in stool surveillance cultures. J. Clin. Microbiol. 43:5639‐5641.
Crossref

  
 

Lee GC (2012). Epidemiology and treatment of KPC'S…What'S the news? Review of Current Evidence. Pharmacotherapy Rounds 2012 

View

  
 

Marschall J, Robert J, Tibbetts W, Dunne M, Frye J, Fraser V, and Warren D (2009). Presence of the KPC carbapenemase gene in enterobacteriacea causing bacteremia and its correlation with in vitro carbapenem susceptibility. J. Clin. Microbiol. 47(1):239-241.
Crossref

  
 

Nordmann P, Poirel L, Dortet L (2012). Rapid Detection of Carbapenemase producing Enterobacteriaceae. Emerg. Infec. Dis.18:1503-1510.
Crossref

  
 

Nordmann P, Naas T, and Poirel L (2011). Global spread of carbapenemase producing enterobacteriaceae. Emerg. Infect. Dis.17(10):105-109.
Crossref

  
 

Papadimitriou-Olivgeris M, Fligou F, Marangos M, Bartzavali C, Vamvakopoulou S, Sklavou C, Anastassiou ED, Christofidou M, Filos K (2012). Risk factors for KPC-producing Klebsiella pneumoniae faecal carriage of patients admitted at an intensive care unit. 22nd Europ. Congress Clin. Microbiol. Infect. Dis. (ECCMID) 31.03.2012 - 03.04.2012 .

  
 

Patel G, Huprikar S, Factor SH, Jenkins S, and Calfee DP (2008): Outcomes of Carbapenem‐Resistant Klebsiella pneumoniae Infection and the Impact of Antimicrobial and Adjunctive Therapies. Infect. Control Hosp. Epidemiol. 29(12):1099-1106.
Crossref

  
 

Phumisantiphong U (2011). Incidence of carbapenem resistant Enterobacteriaceae. Vajera Med. J. 55(3):265-272.

  
 

Qi Y, Wei Z, Ji S, Du Z, Shen P, Yu Y (2011). ST11, the dominant clone of KPC‐producing Klebsiella pneumoniae in China. J. Antimicrob. Chemother. 66:307‐312.
Crossref

  
 

Queenan A, Bush K (2007). Carbapenemases: the Versatile β‐ Lactamases. Clin. Microbiol. Rev. 20:440-458.
Crossref

  
 

Raghunathan A, Samuel L, and Tibbetts RL (2011). Evaluation of a Real-Time PCR Assay for the Detection of the Klebsiella pneumoniae Carbapenemase Genes in Microbiological Samples in Comparison With the Modified Hodge Test Am. J. Clin. Pathol. 135:566-571.
Crossref

  
 

Rapp RP, Urban C (2012). Klebsiella pneumoniae carbapenemases in Enterobacteriaceae: history, evolution, and microbiology concerns. Pharmacotherapy. 32(5):399-407.
Crossref

  
 

Samra Z, Ofir O, Lishtzinsky Y, Madar-Shapiro L, Bishara J (2007). Outbreak of carbapenem-resistant Klebsiella pneumoniae producing KPC-3 in a tertiary medical centre in Israel. Int. J. Antimicrob. Agents. 30:525-534.
Crossref

  
 

Sbrana F, Malacarne P, Bassetti M, Tascini C, Vegnuti L, Della Siega P, Ripoli A, Ansaldi F, Menichetti F (2016). Risk factors for ventilator associated pneumonia due to KPC-producing Klebsiella pneumoniae in mechanically ventilated patients with tracheal and rectal colonization. Minerva Anestesiol. 8 Jan 2016.

  
 

Schechner V, Straus-Robinson K, Schwartz D, Pfeffer I, Tarabeia J, Moskovich R, Chmelnitsky I, Schwaber MJ, Carmeli Y, Navon-Venezia S (2009). Evaluation of PCR-based testing for surveillance of KPC-producing carbapenem-resistant members of the Enterobacteriaceae family. J. Clinical Microbiol. 47(10):3261-3265.
Crossref

  
 

Thomson K (2010). Extended‐Spectrum‐β‐Lactamase, AmpC, and carbapenemase Issues. J. Clin. Microbiol. 48(4):1019-1025.
Crossref

  
 

Tibbetts R, Frye JG, Marschall J, Warren D, Dunne W (2008). Detection of KPC-2 in a clinical isolate of Proteus mirabilis and first reported description of carbapenemase resistance caused by a KPC β-lactamase in P. mirabilis. J. Clinical Microbiol. 46(9):3080-3083.
Crossref

  
 

Tuon FF, Rocha JL, Toledo P, Arend LN, Dias CH, Leite TM,

  
 

Penteado-Filho SR, Pilonetto M, Zavascki AP (2012) . Risk factors for KPC-producing Klebsiella pneumoniae bacteremia. Braz. J. Infect. Dis. 16(5):416-419.
Crossref

  
 

Villegas MV, Lolans K, Correa A, Suarez CJ, Lopez JA, Vallejo M, Quinn JP (2006). Colombian Nosocomial Resistance Study Group, First detection of the plasmid-mediated class A carbapenemase KPC-2 in clinical isolates of Klebsiella pneumoniae from South America. Antimicrobial Agents Chemother. 50(8):2880-2882.
Crossref

  
 

Woodford N, Zhang J, Warner M, Kaufmann M, Matos J, Yang Q, Wang H, Sun H, Chen H, Xu Y, Chen M (2010). Phenotypic and genotypic characterization of Enterobacteriaceae with decreased susceptibility to carbapenems: Results from large hospital‐based surveillance studies in China. J. Antimicrob. Chemother. 54(1):573‐377.
Crossref

  

 




Copyright © 2025 Author(s) retain the copyright of this article.

This article is published under the terms of the Creative Commons Attribution License 4.0

Back to Vol. 10 No. 34
Back to articles
SUBSCRIBE TO RSS
SUBMIT MANUSCRIPT
CONFERENCES
          */?>