2024-07-27T02:34:00Z https://academicjournals.org/oai-pmh/handler

oai:academicjournals.org:AJBR:08041929637 2007-06-30T00:00:00Z AcademicJournals AJBR AJBR:2007

Occurrence of malondialdehyde and N- nitrosamines and their precursors in some Nigerian ice creams, yogurts, meat and fish species Okafor, P. N, Nwosu, O, Chukwu, J, Agbayi, J and Maduagwu, E. N Full Length Research Paper The malondialdehyde (a deleterious by-product of lipid peroxidation) and N-nitrosamines and their precursors (nitrate and nitrite) content of seven (7) and three (3) brands of Nigerian yogurts and ice-creams respectively as well as that of some meat and fish samples were determined using chemical methods. Malondialdehyde and nitrite were estimated spectrophotometrically, nitrate after reduction to nitrite with cadmium column and N-nitrosamines after decomposition to nitrite using U.V irradiation. Malonaldehyde was detected in all the samples of both ice-creams and yogurts and in some meat and fish samples with mean concentration of 1.79 plusmn; 0.13- 9.11 plusmn; 2.67 g/ml in the food drinks and 0.51plusmn;0.01 - 1.68 plusmn; 0.03 g/g and N.D ndash; 12.95 plusmn; 1.07 g/g in fish and meat samples respectively. All the brands of ice- creams and yogurts (except Brand B) analyzed contained detectable amounts of nitrite. The mean values in g/ml ranged 0.06 plusmn; 0.01 ndash; 0.2plusmn;0.01 g/ml for ice creams and 0.07 plusmn; 0.01 ndash; 0.04 plusmn; 0.02 g/ml for yogurts. Measurable concentrations of nitrate (0.64 plusmn; 0.04 ndash; 4.91 plusmn; 0.51 g/ml) and N-nitrosamines were also found in some of these food drinks. The toxicological implications of these findings are discussed. Key words: Malondialdehyde, nitrate, nitrite, n-nitrosamines, ice creams, yogurts, fish, meat. Academic Journals 2007 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/08041929637 http://dx.doi.org/10.5897/AJBR.9000177 en Copyright © 2007 Okafor, P. N, Nwosu, O, Chukwu, J, Agbayi, J and Maduagwu, E. N

oai:academicjournals.org:AJBR:305F2809646 2007-06-30T00:00:00Z AcademicJournals AJBR AJBR:2007

Effect of carbon sources on cellulase (EC 3. 2. 1. 4) production by Penicillium chrysogenum PCL501 Nwodo-Chinedu, S., Okochi, V. I., Smith, H. A., Okafor, U. A., Onyegeme-Okerenta, B. M. and Omidiji, O. Full Length Research Paper The effects of glucose, crystalline cellulose and sawdust of Mitragyna cilata on the growth and cellulase production, inferred from cellulase (EC 3. 2. 1. 4) activity, of Penicillium chrysogenum PCL501 was determined. Glucose-containing media gave the highest mycelia weight of 1.78 mg mL-1 in 120 h of incubation. This is about 3.5 ndash; 4.5 times the maximum weights of 0.51 and 0.40 mg mL-1 respectively obtained from the cultures containing cellulose and sawdust. The cultures containing crystalline cellulose and sawdust produced extracellular protein with cellulase (EC 3. 2. 1. 4) activity whereas glucose-containing cultures yielded very low protein and no significant cellulase activity. Maximum protein content of 0.02, 0.13 and 0.46 mg mL-1 respectively were obtained from the cultures containing glucose, cellulose and sawdust. Peak cellulase activity values of 100.0 and 92.2 Units L-1 respectively were obtained for the cultures containing cellulose and sawdust. There is a correlation between the protein released and cellulase activity of the culture filtrates. P. chrysogenum PCL501 produces extracellular proteins with significant cellulase activity in media containing cellulose and sawdust but not in glucose-containing medium. Sawdust is indicated as a good inducer of cellulase activity in the organism. The waste cellulosic material can be used as low-cost carbon source for commercial cellulase production. Key words: P. chrysogenum PCL501, growth, cellulase activity, glucose, cellulosic materials. Academic Journals 2007 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/305F2809646 http://dx.doi.org/10.5897/AJBR.9000084 en Copyright © 2007 Nwodo-Chinedu, S., Okochi, V. I., Smith, H. A., Okafor, U. A., Onyegeme-Okerenta, B. M. and Omidiji, O.

oai:academicjournals.org:AJBR:2269D6D9659 2007-07-30T00:00:00Z AcademicJournals AJBR AJBR:2007

Removal of iron, zinc and magnesium from polluted water samples using thioglycolic modified oil-palm fibre J. O. Akaninwor, M. O. Wegwu and I. U. Iba Short Communication Various kinds of agro and wood based fibres can be used to filter both trace and heavy metals from contaminated solutions. The efficacy of thioglycolic acid treated oil-palm fibre was investigated in this study. The result showed maximum absorptions (at pH = 6) of 83.6, 75.6 and 50.8% for Fe++, Zn++ and Mg++ respectively in the Southern Point (SP) samples. Similarly, 79.1, 78.3 and 77.5% for Fe++, Zn++ and Mg++ were obtained for Northern Point (NP) samples. The removal efficiency of the metals was pH as well as ionic size dependent. The uptake capacities showed that iron had a higher capacity than zinc while magnesium had the least. This study therefore suggests that thioglycolic acid modified oil-palm fibre is highly efficient in sorption of metals from solutions and should be used as such at a slightly acidic pH. Key words: Heavy metal removal, thioglycolic acid modified oil-palm fibre. Academic Journals 2007 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/2269D6D9659 http://dx.doi.org/10.5897/AJBR.9000208 en Copyright © 2007 J. O. Akaninwor, M. O. Wegwu and I. U. Iba

oai:academicjournals.org:AJBR:60791CA9667 2007-07-30T00:00:00Z AcademicJournals AJBR AJBR:2007

Some valuable fatty acids exposed from wedge clam Donax cuneatus (Linnaeus) Annaian Shanmugam, Chendur Palpandi and Subramanium Sambasivam Full Length Research Paper The fatty acid composition of the wedge clam Donax cuneatus collected from the sandy beach of Cuddalore (southeast coast of India) was determined. In the analysis, the fatty acid profile by gas chromatography revealed the presence of higher amount of saturated fatty acids (35.28%) than mono (12.71%) and polyunsaturated (11.72%) fatty acids. Among the saturated fatty acids, the stearic acid contributed the maximum amount of 15.68%. Whereas the monounsaturated fatty acids (MUFA) were accounted for 26.57% with mostly 16:1w7c (12.71%), fatty acid. Among the PUFA 20:4 w6c (6.75%) and 18:2 w6c (2.41%) acid contents were high. Omega ndash; 6 fatty acids accounted for 10.74% of total PUFA and omega ndash; 3 fatty acids were accounted for 0.48%. Thus the present study enlightens the possible role of this clam in the field of human nutrition. Key words: Fatty acids, SFA, MUFA, PUFA, Donax cuneatus Academic Journals 2007 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/60791CA9667 http://dx.doi.org/10.5897/AJBR.9000219 en Copyright © 2007 Annaian Shanmugam, Chendur Palpandi and Subramanium Sambasivam

oai:academicjournals.org:AJBR:B57A87C9671 2007-07-31T00:00:00Z AcademicJournals AJBR AJBR:2007

Numerical simulation of the internal vibrations of COOH group in amino-salicylic acids Y. P. Singh, Ratnesh Das and R. A. Singh Full Length Research Paper Our present work reports the IR spectra of amino substituted salicylic acids recorded by FTIR spectrometer and also simulated theoretically. The simulation was performed using GF matrix and AM1, PM3, DFT method. In this work, the following steps were taken: optimizing the geometry, computing the IR spectra and comparing it with experimental spectra. Assuming Cspoint symmetry, vibrational assignments for the observed frequencies have been proposed. The spectra exhibit distinct features originating from low frequency vibrational modes caused by intra-molecular motion. Key words: o-amino salicylic acid, m-amino salicylic acid, p-amino salicylic acid, FTIR spectra, vibrational spectra, AM1, PM3, DFT, G-F Matrix. Academic Journals 2007 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/B57A87C9671 http://dx.doi.org/10.5897/AJBR.9000175 en Copyright © 2007 Y. P. Singh, Ratnesh Das and R. A. Singh

oai:academicjournals.org:AJBR:22BEAF69691 2007-08-31T00:00:00Z AcademicJournals AJBR AJBR:2007

Suppression-subtractive hybridization: A rapid and inexpensive detection methodology for up-regulated Perkinsus olseni genes Ascenso R. M. T., Leite R. B., Afonso R., Cancela M. L. Full Length Research Paper A cDNA forward subtraction library was constructed from the mollusc parasite Perkinsus olseni exposed to hemolymph from its natural host, the clam Ruditapes decussatus, and two different methodologies were used to unravel different non-redundant contigs. Our results demonstrated that screening of the non-enriched direct cDNA subtractive library (Dfsl) was the most efficient and least time- consuming method. It facilitated the identification of genes belonging to 25 different classes of molecular functions out of the 96 clones analyzed. In contrast, only 6 different classes from 204 sequenced clones were identified from the enriched library (efMOSl). It was concluded that the Dfsl cDNA subtractive library resulted in a larger pool of diversified gene hits that were obtained in a shorter time and with less technically-demanding methodology when compared to the efMOSl approach, thus demonstrating its significance and usefulness when time and/or resources are limited. Key words: Unicellular parasite; Perkinsus olseni; SSH; bacterial dot blot and plate lifts Academic Journals 2007 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/22BEAF69691 http://dx.doi.org/10.5897/AJBR.9000227 en Copyright © 2007 Ascenso R. M. T., Leite R. B., Afonso R., Cancela M. L.

oai:academicjournals.org:AJBR:1721B739694 2007-08-31T00:00:00Z AcademicJournals AJBR AJBR:2007

Analysis of phenolic compounds in Ugandan sweet potato varieties (NSP, SPK AND TZ) Agnes M. Nandutu, Mike Clifford and Nazlin K. Howell Full Length Research Paper Sweet potato varieties: Nsp, Tz and Spk obtained from Uganda were used in this study. Several phenolic compounds were identified on the basis of their mass spectra in full scan mode and the pattern of their fragmentation. The major compounds found were caffeoylquinic acid, dicaffeoylquinic acid, coumaroylquinic acid, feruloylquinic acid and caffeoylferuloylquinic acids.This is the first time that caffeoylferuloylquinic isomers have been identified in sweet potato samples. Key words: Sweet potato, phenolic compounds, chlorogenic acids. Academic Journals 2007 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/1721B739694 http://dx.doi.org/10.5897/AJBR.9000021 en Copyright © 2007 Agnes M. Nandutu, Mike Clifford and Nazlin K. Howell

oai:academicjournals.org:AJBR:F653AB79706 2007-08-31T00:00:00Z AcademicJournals AJBR AJBR:2007

Altered plasma hexose sugar metabolism in sickle cell anaemia Chidi G. Osuagwu and Chika U. Mbeyi Full Length Research Paper Theoretical suggestion that the metabolism and plasma levels of some hexoses (glucose and fructose) in sickle cell anaemia could be altered was investigated. The levels were determined for 35 normal (HbAA) and for the three sickle cell states (32 HbAS; 35 HbSS, and 33 HbSS-in-crisis, HbSSc). The enzymatic glucose-oxidase method was employed in glucose estimation. The reaction of fructose with indole-3-acetic acid to yield a coloured product was exploited in the estimation of fructose. Mean plasma glucose was found to be highest in the HbSSc state (84.80 plusmn; 4.10 mg/dl), followed by HbSS (78.59 plusmn; 4.20 mg/dl), HbAS (74.80 plusmn; 6.20 mg/dl) and lowest in HbAA (70.10 plusmn; 0.05 mg/dl). The differences between the normal and all the disease states are significant (between HbAS and HbAA, for example: t = 2.2717; df = 65; p lt; 0.05). The reverse order was observed with respect to fructose concentrations: lowest in HbSSc (0.99 plusmn; 0.05 mg/dl), HbSS (1.09 plusmn; 0.05 mg/dl), HbAS (1.25 plusmn; 0.05 mg/dl), and highest in HbAA (1.32 plusmn; 0.08 mg/dl). Regression of glucose on fructose showed positive correlation in the HbAA group (r = 0.7900; df = 33; p lt; 0.001), no correlation in the HbAS group (r = - 0.0193; df = 30; p gt; 0.20), and negative correlation in the HbSS group (r = - 0.3191; df = 65; p lt; 0.001). The differences between the lsquo;Glucose-to-Fructose Ratiorsquo; for the different states are very significant (plt;0.001) and could serve as biomarker of sickle cell anaemia intensity. Key words: Hexose, anergy, glucose, fructose, spermatozoa, energy metabolism, metabolic control, sickle cell anaemia, glucose-to-fructose ratio. Academic Journals 2007 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/F653AB79706 http://dx.doi.org/10.5897/AJBR.9000018 en Copyright © 2007 Chidi G. Osuagwu and Chika U. Mbeyi

oai:academicjournals.org:AJBR:4B7B7C09723 2007-09-30T00:00:00Z AcademicJournals AJBR AJBR:2007

Physicochemical and microbiological characteristics of optimized and traditional shea butters from Côte d’Ivoire Rose-Monde Megnanou , Seacute;bastien Niamke and Jacques Diopoh Full Length Research Paper A comparison was realized between the characteristics of shea butters from local markets in Cocirc;te drsquo;Ivoire and optimized shea butters, manufactured in a laboratory, in order to valuate the improvements in quality. Large diversity concerning the colour (beige, grey and yellow), odour (odourless, moderate, fragrant and rancid) and the consistency (soft and hard) was found for the ordinary shea butter while the optimized one presented specific sensorial characteristics (beige or yellow colour, moderate odour and soft consistency). The acid (10.51 and 11.94 mgKOH/g), peroxide (5.77 and 2.79 mEgO2/kg) and moisture content (0.15%) values of the optimized shea butter were much lower than those of the marketed ones which were 12.80 to 17.32 mgKOH/g, 14.70 to 30.88 mEgO2/kg and 3.26 to 14.50%, respectively. Moreover, the optimized shea butters were free from heavy metals (lead and nickel), Salmonella and the microbial (coliforms), yeast and moulds contents were lower compared to the marketed shea butters. In addition, the optimized shea butters had a high unsaponifiable content (17.61%) and some minerals such as calcium (212.26 to 238.85 mg/kg), sodium (84.57 to 136.62 mg/kg), potassium (36.41 to 45.17 mg/kg), magnesium (12.18 mg/kg), zinc (1.90 mg/kg) and iron (1.67 mg/kg). Key words: Shea butter, Vitellaria paradoxa, properties, quality, Cocirc;te drsquo;Ivoire. Academic Journals 2007 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/4B7B7C09723 http://dx.doi.org/10.5897/AJBR.9000186 en Copyright © 2007 Rose-Monde Megnanou , Seacute;bastien Niamke and Jacques Diopoh

oai:academicjournals.org:AJBR:AD0DF299733 2007-09-30T00:00:00Z AcademicJournals AJBR AJBR:2007

Xylanase production by Penicillium chrysogenum (PCL501) fermented on cellulosic wastes Okafor, U. A., Emezue, T. N., Okochi, V. I. , Onyegeme-Okerenta, B. M. and Nwodo-Chinedu, S. Full Length Research Paper Xylanase production by Penicillium chrysogenum PCL501, newly isolated from wood-wastes, was monitored at 24 h intervals for a period 168 h in media containing four different carbon sources (oat-spelt xylan, wheat bran, sawdust, and sugarcane pulp). The highest xylanase activity of 6.47 Units mL-1 was obtained at 96 h in media containing wheat bran whereas media containing sugarcane pulp gave a peak value of 1.39 Units mL-1 at 144 h. Sawdust and xylan gave a peak xylanase activity of 1.35 and 0.79 Units mL-1 respectively at 120 h. Maximum protein released in xylan-containing media was 0.38 mg mL-1. Higher protein yield was obtained in media containing the agro-wastes, with wheat bran giving the highest value of 1.14 mg mL-1. The maximum specific xylanase activities were 2.59, 8.52, 16.06, and 9.36 Units mg Protein -1 for sawdust, sugarcane pulp, wheat bran and xylan respectively. Out of the three agro-wastes used in this study, wheat bran holds the greatest promise for cost-effective production of the xylanase enzyme. The carbon source is the highest inducer of the enzyme in the fungus. Key words: Penicillium chrysogenum PCL501, agro-wastes, wheat bran, sawdust, sugarcane pulp, xylanase. Academic Journals 2007 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/AD0DF299733 http://dx.doi.org/10.5897/AJBR.9000261 en Copyright © 2007 Okafor, U. A., Emezue, T. N., Okochi, V. I. , Onyegeme-Okerenta, B. M. and Nwodo-Chinedu, S.

oai:academicjournals.org:AJBR:F968AD19737 2007-09-30T00:00:00Z AcademicJournals AJBR AJBR:2007

Sickle-cell anaemia in Nigeria: dermatoglyphic analysis of 90 cases Oladipo GS, Olabiyi O, Oremosu AA, Noronha CC, Okanlawon AO and Paul CU. Full Length Research Paper Dermatoglyphic analysis of 90 Sickle-cell Anaemia cases and 90 normal subjects was carried out in this study. It involved the digital patterns, ATD angle, A ndash; B ridge count, axial triradius, digital triradius and palmar crease on the hands. 58.44% of the digital patterns in sickle-cell cases were ulnar loop as against 60.14% in the normals. The percentage of Whorl, arch and radial loop in Sickle-Cell group were 31.64%, 8.23% and 2.98% respectively as against 27.47%, 10.43% and 1.98% in the normals. The mean ATD values were 41o and 40o for the normal and sickle-cell groups respectively. The mean A ndash; B ridge counts was 33.1 in sickle-cell group and 33.5 in the normals. No axial triradius was found in tiii (along the distal transverse crease) position in both groups. Most of the triradii were found in position ti (along or close to the thenar crease) in both groups. Only 3.6% of normals and 2.9% sickle-cell cases were found in tii (along the proximal transverse crease) position. The mode of the frequency distribution of digital triradii of normals was 13 while they were 11, 14 and 15 for sickle-cell group. The means were 11.89 and 12.32 respectively. No Simean crease was found in both groups; however, 2.2% of the 90 sickle-cell cases had Sidney creases. The above-mentioned values were not statistically different when the two groups were subjected to appropriate statistical tests. Key words: Dermatoglyphics, sickle-cell anaemia, Nigeria. Academic Journals 2007 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/F968AD19737 http://dx.doi.org/10.5897/AJBR.9000217 en Copyright © 2007 Oladipo GS, Olabiyi O, Oremosu AA, Noronha CC, Okanlawon AO and Paul CU.

oai:academicjournals.org:AJBR:EA8EAC49751 2007-09-30T00:00:00Z AcademicJournals AJBR AJBR:2007

Biological responses of injured human skin fibroblasts to assess the efficacy of in vitro models for cell stress studies Innocent Lutho Zungu, Denise Hawkins Evans, Nicolette Houreld and Heidi Abrahamse Full Length Research Paper The classical central scratch method has been used to successfully induce a wound environment however this model has been criticized. This study aimed to compare the cellular responses of normal fibroblast cells with those of wounded, diabetic wounded, acidic and hypoxic cells to determine if the latter two models are more effective in inducing an injured environment than the central scratch method. The cellular responses that were evaluated included; cell morphology, viability, proliferation, cytotoxicity and DNA damage. The results from this study showed that the biochemical tests were sensitive enough to distinguish changes between normal and wounded, diabetic wounded, acidic and hypoxic cells. Wounded cells showed a decrease in ATP viability, increase in caspase 3/7 activity, increase in proliferation and increase in cytotoxicity and DNA damage when compared to normal cells. This study confirmed that although a central scratch method only wounds 5 - 10% of the surface cells it was sufficient to successfully induce a wound environment in vitro. The results suggest that the in vitro models may not only be used to study wound healing but also cellular responses related to other pathological conditions such as heart attack, stroke, diabetes and biological or biochemical changes in response to treatment such as laser therapy otherwise known as phototherapy. Key words: Acidosis, diabetic, fibroblasts, hypoxia, injury, wounds. Academic Journals 2007 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/EA8EAC49751 http://dx.doi.org/10.5897/AJBR.9000049 en Copyright © 2007 Innocent Lutho Zungu, Denise Hawkins Evans, Nicolette Houreld and Heidi Abrahamse

oai:academicjournals.org:AJBR:7229DFE9764 2007-10-31T00:00:00Z AcademicJournals AJBR AJBR:2007

Impact of processing technique on the apparent bioavailability of cooking banana (matooke) starch Florence Isabirye Muranga, Harini Sampath, Judith A. Marlett and James M. Ntambi, Full Length Research Paper The aim of the study was to compare the apparent bioavailability of starch in raw, cooked and extruded matooke flours using weanling mice. Two control and three test groups consisting of seven mice each (initial body weight of 21.32 plusmn; 1.05 g) were fed diets incorporating soluble unavailable starch (Control I), soluble starch (Control II) and raw, cooked and extruded matooke flours as carbohydrate bases, for three weeks. The growth rate, food intake, adipose tissue size and 12 h fasting glucose levels were measured. The mean values of the growth parameters were separated by ANOVA using GENSTAT statistical package. There was a significant difference (Plt;0.001) in food intake between the control and test groups. The mice fed on solubilised matooke starches (cooked and extruded) exhibited significantly higher (Plt;0.001) growth rates than the ones fed on raw starch, showing a higher apparent bioavailability of the former flours. The mice fed on Control I appeared malnourished despite an excessively high food intake. The raw matooke group displayed less pronounced symptoms of malnourishment despite recording the highest weight loss. The fat pad sizes were in agreement with the growth rate data. The glucose levels, though on the lower side particularly in the Control I and raw matooke flour groups, were within the normal range. The results demonstrated that solubilised matooke starches adequately met the energy requirement of a growing animal. Nonetheless extrusion cooking appeared to confer a marginal advantage over the cooked flour, due to extruded flourrsquo;s lower peak viscosity. This advantage would be enhanced in humans if the rations are taken as porridges. Key words: Starch-bioavailability, matooke, protein-energy malnutrition. Academic Journals 2007 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/7229DFE9764 http://dx.doi.org/10.5897/AJBR.9000136 en Copyright © 2007 Florence Isabirye Muranga, Harini Sampath, Judith A. Marlett and James M. Ntambi,

oai:academicjournals.org:AJBR:0F91EF89774 2007-10-31T00:00:00Z AcademicJournals AJBR AJBR:2007

N-nitrosodimethylamine induced changes in the activities of carcinogen-metabolizing enzymes in the liver of male mice: role of glutathione and gossypol as antioxidants Sheweita S. A., Mousa N. and Newairy A. A. Full Length Research Paper The importance of nutrition in protecting living organisms from the toxic effects of environmental carcinogens has attracted the attention of many researchers. In order to exert their toxic and/or carcinogenic effects, most carcinogens need to be activated primarily by phase I drug-metabolizing enzymes including; cytochrome P450, cytochrome b5, arylhydrocarbon hydroxylase (AHH), N-nitroso-dimethylamine N-demethylase I (NDMA-N-dI), NADPH-cytochrome c reductase and the expression of cytochrome P450 2E1. Changes in the activity of these enzymes were determined in livers of male mice pretreated with either glutathione (GSH) or gossypol as antioxidants, for seven consecutive days before administration of NDMNA as single dose for two hours before decapitation of mice. The total hepatic content of cytochrome P450 and AHH activity were induced, whereas the activity of NDMA-N-dI and expression of cytochrome P450 2E1 were reduced after treatment of mice with NDMA as a single dose. On the other hand, preteatments of mice with either gossypol or GSH for seven consecutive days decreased the total cytochrome P450 content as well as AHH activity whereas the activity of NDMA-N-dI and the expression of cytochrome P450 2E1 increased. Treatment of mice with NDMA only induced the total hepatic content of cytochrome P450 and AHH activity. Interestingly pretreatment of mice with GSH for seven consecutive days before injection of NDMA was found to restore the induced cytochrome P450 and AHH activity caused by NDMA to their normal levels. However, pretreatment of mice with gossypol prior to administration of NDMA did not restore such activities to their normal levels. Treatment of mice with either GSH or gossypol induced the expression of cytochrome P450 2E1. Interestingly, gossypol/NDMA treated mice restored the induced cytochrome P450 2E1 expression, caused by gossypol, to its normal level. However, GSH/NDMA-treated mice did not restore the induced level of cytochrome P450 2E1 caused by GSH, to its normal level. It is concluded that, pretreatment of mice with GSH and gossypol prior to administration of NDMA induced the expression of cytochrome P450 2E1. Therefore, GSH and gossypol, could induce the toxicity and/or carcinogenicity of N-nitrosamines whereas they might protect the liver and probably other organs from the toxic and carcinogenic effects of other carcinogens such as polycyclic aromatic hydrocarbons, e.g. benzo[a]pyrene, through inhibition of total cytochrome P450 content and AHH activity. Key words: Aryl hydrocarbon hydroxylase, Cytochrome P450 2E1, N-nitrosodimethylamine N- demethylase, glutathione, antioxidants. Academic Journals 2007 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/0F91EF89774 http://dx.doi.org/10.5897/AJBR.9000170 en Copyright © 2007 Sheweita S. A., Mousa N. and Newairy A. A.

oai:academicjournals.org:AJBR:030B4719783 2007-10-31T00:00:00Z AcademicJournals AJBR AJBR:2007

Biochemical assessment of the effects of crude oil contaminated catfish (Clarias gariepinus) on the hepatocytes and performance of rat T. O. Sunmonu and O. B. Oloyede Full Length Research Paper Biochemical investigations were carried out to assess the effect of consumption of crude oil contaminated catfish on the hepatocytes and performance of rat. Catfish (Clarias gariepinus) (n = 120) were grouped into 6 of 20 catfish each and held for 30 h in 5 different mixtures of crude oil polluted water (0.1, 0.25, 0.5, 0.75 and 1% v/v). Catfish in the control group were held in borehole water. At the expiration of 30 h, the catfish were harvested and used to formulate diet. Albino rats (n = 60) were grouped into 6 of 10 rats each and fed on the formulated diet for a period of 30 days. Compared with the control, the result showed no significant difference (pgt;0.05) in the average daily feed intake in all the groups of rats. However, a significant reduction (plt;0.05) was observed in the overall body weight, the liver-to-body weight ratio as well as the serum concentrations of albumin and globulin of rat as the amount of crude oil in the diet increased. A significant increase (plt;0.05) was also observed in the serum bilirubin concentration of rats fed on diet formulated with crude oil contaminated catfish when compared with the control. Histological analysis also revealed that the architectural arrangement of the liver was altered following the consumption of diet containing catfish exposed to crude oil polluted water. Overall, the data obtained indicate a possible adverse effect on the performance and impaired liver function in the rats fed on diet containing catfish exposed to crude oil polluted water. Key words: Crude oil, hepatocytes, catfish, albumin, globulin, bilirubin. Academic Journals 2007 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/030B4719783 http://dx.doi.org/10.5897/AJBR.9000043 en Copyright © 2007 T. O. Sunmonu and O. B. Oloyede

oai:academicjournals.org:AJBR:5DBBB069800 2007-11-30T00:00:00Z AcademicJournals AJBR AJBR:2007

Lavudine therapy and hepatotoxicity as seen in a Nigerian tertiary antiretroviral treatment centre Akande A.A, Olaosebikan O.F, Jimoh A.K, Abdulazeez, Olawumi H.O Full Length Research Paper Hepatic toxicity is a common complication of anti-retroviral treatment in HIV patients, usually indicated or heralded by the elevation of liver transaminases measured in the blood. There had been reported evidence of hepatic toxicity in all the three currently approved classes of anti-retroviral drugs. However, its severity in some cases may warrant stoppage of the treatment. This study assessed the hepato-toxicity among HIV patients on antiretroviral therapy with lavudine in a drug treatment centre in Nigeria. Liver function test (LFT) results of patients treated with lavudine (lamivudne, stavudine and nevirapine) antiretroviral drug was collated and analyzed initially as baseline data and later over a period of three months after treatment with lavudine for liver enzymes assessment. Sixty three (63) subjects in all were analyzed, 28 males and 35 females (M: F = 0.8:1). The results showed that there was a non-significant (pgt;0.45) decrease in the serum transaminases and alkaline phosphatase of the pretreatment LFT compared with the LFT after three months of treatment with lavudine. The levels of serum total protein and albumin showed a concomitant but non-significant (pgt;0.20) decrease over the same period. Antiretroviral treatment with lavudine may be associated with hepatic enzymes induction but not toxicity at least in the short run, however hepatic function test should be monitored every month for the first three months after starting a new drug regimen and followed by once in six month subsequently for a year. Key words: Lavudine, hepatotoxicity, treatment centre, HIV /AIDS patient. Academic Journals 2007 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/5DBBB069800 http://dx.doi.org/10.5897/AJBR.9000153 en Copyright © 2007 Akande A.A, Olaosebikan O.F, Jimoh A.K, Abdulazeez, Olawumi H.O

oai:academicjournals.org:AJBR:31BF88F9810 2007-11-30T00:00:00Z AcademicJournals AJBR AJBR:2007

Quantitation of alcohols in orange wine fermented by four strains of yeast Okunowo, Wahab Oluwanisola and Osuntoki, Akinniyi Adediran Full Length Research Paper Gas liquid chromatography was used to identify the types of alcohol present in wines produced by fermenting orange juice with four strains of yeast; Saccharomyces cerevisiae (isolated from yam), S. cerevisiae (from sugarcane molasses),Saccharomyces carlsbergensis (from sugarcane molasses) and S. cerevisiae var. ellipsoideus (from orange juice). Ethanol and methanol were the predominant alcohols. The ethanol content was highest, 90.38% with S. cerevisiae var. ellipsoideus and least, 81.49% with S. cerevisiae (from sugarcane molasses). The methanol concentration varied between 9.51% with S. cerevisiae var. ellipsoideus and 14.93% with S. carlsbergensis. The other alcohol detected, isopro-panol was generally negligible; 0.10 to 0.25% except with S. cerevisiae (from sugarcane molasses) which produced it as 5.46% of the total alcohol. The total alcohol was highest, 6.50 plusmn; 0.15% with S. carlsbergensis and least 3.23 plusmn; 0.12 with S. cerevesiae var. ellipsoideus. Key words: Alcohol types, fermentation, orange wine, Saccharomyces, yeast strains. Academic Journals 2007 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/31BF88F9810 http://dx.doi.org/10.5897/AJBR.9000201 en Copyright © 2007 Okunowo, Wahab Oluwanisola and Osuntoki, Akinniyi Adediran

oai:academicjournals.org:AJBR:D52468A9819 2007-11-30T00:00:00Z AcademicJournals AJBR AJBR:2007

Effect of Emblica officinalis against alcohol-induced biochemical changes in plasma and red blood cells of rats Damodara Reddy. V, Saayi Krushna G, Padmavathi. P and Varadacharyulu. N.Ch Full Length Research Paper Alcohol is widely abused as a psychoactive drug. Emblica officinalis is known for its therapeutic effects and the present study is aimed at investigating therapeutic efficacy of aqueous extract of Emblica officinalis (AEEO) against alcohol-induced damage. Thirty three percent (v/v) alcohol (10 g/kg body weight) and AEEO (250 mg/kg body weight/day) was orally administered once a day for 60 days. Chronic alcohol feeding resulted in higher activities of the alcoholic plasma marker enzyme gamma glutamyl transferase (gamma;GT) and abnormalities in plasma lipid and lipoproteins, minerals as well as activities of plasma transaminases (AST and ALT), alkaline phosphatase (ALP) and lactate dehydrogenase (LDH). Chronic alcohol administration significantly lowered the activities of superoxide dismutase (SOD), catalase (CAT) glutathione peroxidase (GPx) and the content of reduced glutathione (GSH) in erythrocytes. The AEEO supplementation to chronically alcohol fed rats beneficially modulated plasma lipids and lipoprotein patterns, minerals, and vitamin C and also corrected zigzags in plasma enzyme activities and improved antioxidant and defense enzyme machinery status. However, AEEO supplementation resulted in a significant increase in GSH content and the activities of SOD, CAT and GPx. AEEO can contribute to the alleviation of alcohol induced adverse effects by enhancing the status of antioxidant defense system and by regulating lipid and mineral metabolism. Key words: Alcohol; Antioxidant enzymes; Emblica officinalis; Lipid profile. Academic Journals 2007 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/D52468A9819 http://dx.doi.org/10.5897/AJBR.9000087 en Copyright © 2007 Damodara Reddy. V, Saayi Krushna G, Padmavathi. P and Varadacharyulu. N.Ch

oai:academicjournals.org:AJBR:CAC75479830 2007-11-30T00:00:00Z AcademicJournals AJBR AJBR:2007

Biochemical characterization of two α -mannosidases from breadfruit (Artocarpus communis) seeds Amedeacute;e Pascal Ahi, Jean Tia Gonnety, Betty Meuwiah Faulet, Lucien Patrice Kouameacute; and Seacute;bastien Niamkeacute;. Full Length Research Paper The importance of alpha; -mannosidases in glycoproteins processing and their application in food and pharmaceutical industry led us to further explore plant alpha; -mannosidases. Thus, two alpha; -mannosidases were purified from matured breadfruit (Artocarpus communis) seeds, by successive chromatography on Diethylaminoethyl-Sepharose CL-6B and Sephacryl S-200 HR to apparent homogeneity. The two isoenzymes named Ma and Mb had native molecular weights of approximately 75 and 60 kDa, respectively. Sodium Dodecyl Sulfate- polyacrylamide gel electrophoresis of these alpha; -mannosidases resolved a single protein band with molecular weights estimated to be 75 kDa for isoform Ma and 61 kDa for Mb. Breadfruitalpha; -mannosidases had optima pH (5.6) and temperature (60deg;C), and appeared to be stable in presence of some detergents such as Hexansulfonic acid sodium salt, Polyoxyethylen-9-lauryl ether, Nonidet P40, Triton X-100 as well as Ca2+ and Zn2+. The effect of alpha; -mannosidase inhibitors on the two isoenzymes showed that swainsonine and 1,4-dideoxy-1,4-imino mannitol at 0.01 mM totally inhibited their hydrolytic activity, while kifunensine and deoxymannojirimycin at the same concentration had no effect on these enzymes. Substrate specificity tests revealed that the enzymes exerted only alpha; -mannosidase activity and cleaved alpha; -(1,2); alpha; -(1,3) and alpha; -(1,6) linked mannobiose. Since breadfruit seed alpha; -mannosidases were sensitive to furanose transition state analogs such as swainsonine and 1,4-dideoxy-1,4-imino mannitol and showed broad substrate specificity, these enzymes would belong to class II alpha; -mannosidases. Key words: alpha; -mannosidases, Artocarpus communis, breadfruit, purification, characterization. Academic Journals 2007 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/CAC75479830 http://dx.doi.org/10.5897/AJBR.9000044 en Copyright © 2007 Amedeacute;e Pascal Ahi, Jean Tia Gonnety, Betty Meuwiah Faulet, Lucien Patrice Kouameacute; and Seacute;bastien Niamkeacute;.

oai:academicjournals.org:AJBR:5698B059836 2007-11-30T00:00:00Z AcademicJournals AJBR AJBR:2007

Protective effect of betaine on changes in the levels of protein, glycoproteins and amino acids in isoprenaline-induced myocardial infarction in rats B. Ganesan, R. Rajesh, , R. Anandan , and N. Dhandapani, Full Length Research Paper The protective effect of betaine administration on changes in the levels of protein, glycoproteins and amino acids was studied in isoprenaline-induced myocardial infarction in rats as an animal model of myocardial infarction in man. Oral pre-treatment with betaine significantly (Plt;0.05) attenuated the isoprenaline-induced rise in the levels of troponin-T and creatine phosphokinase (CPK). Oral supplementation of betaine also significantly (Plt;0.05) counteracted the isoprenaline-induced alterations in the levels of amino acids (taurine, aspartate, glutamate, arginine, hydroxy proline and homocysteine), protein content, glycoprotein components (hexose and hexosamine) and lipid peroxidation in the heart tissue and maintained their levels comparable to that of control animals. The results indicated that the overall cardioprotective effect of betaine was probably related to its ability to strengthen the myocardial membrane by its membrane stabilizing action or to a counteraction of free radicals by its antioxidant property. Key words: Betaine, myocardial infarction, isoprenaline, glycoproteins, lipid peroxidation. Academic Journals 2007 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/5698B059836 http://dx.doi.org/10.5897/AJBR.9000193 en Copyright © 2007 B. Ganesan, R. Rajesh, , R. Anandan , and N. Dhandapani,

oai:academicjournals.org:AJBR:14F9A3F9844 2007-11-30T00:00:00Z AcademicJournals AJBR AJBR:2007

Garcinia kola extract reduced cisplatin-induced kidney dysfunction in rats Okoko Tebekeme and Awhin Ejiro Prosper Full Length Research Paper The effect of Garcinia kola extract on cisplatin-induced renal insufficiency in rats was studied. A total of fifteen rats were used for the study and were split into three groups of five rats per group. Rats in group I were normal controls. Renal insufficiency was induced in rats of groups II and III by a single intraperitoneal administration of cisplatin (5 mg/kg b.w.). After three days, rats in group III received a daily dose of 10 mg/kg b.w. of the extract orally for another seven days. Renal insufficiency was later assessed by serum urea, serum creatinine and urine protein levels. The results showed that the levels of the measured parameters which were elevated as a result of the cisplatin administration were brought to near normal levels by the G. kola seed extract. This indicates that G. kola possessed significant potentials of ameliorating mild kidney insufficiency induced by the anticancer drug, cisplatin. Key words: Garcinia kola, cisplatin, renal insufficiency, urea, creatinine. Academic Journals 2007 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/14F9A3F9844 http://dx.doi.org/10.5897/AJBR.9000125 en Copyright © 2007 Okoko Tebekeme and Awhin Ejiro Prosper

oai:academicjournals.org:AJBR:91692679859 2007-12-31T00:00:00Z AcademicJournals AJBR AJBR:2007

Status of the levels of lead and selected trace elements in type 2 diabetes mellitus patients in Abeokuta, Nigeria Babalola O. O, Ojo L. O and Akinleye A.O Full Length Research Paper The study investigated the status of lead and selected mineral elements (copper, zinc and chromium) in type-2 diabetes mellitus patients, so as to establish the possible interactive connections of these metals with the disease and with each other in diabetic patients. Thirty-one patients (15 male and 16 female), clinically diagnosed for type-2 Diabetes mellitus at Sacred Heart Hospital, Abeokuta, Nigeria, participated in the study. Twenty-six apparently healthy individuals (14 male and 12 female) served as control group. Blood samples of all the subjects were collected after an overnight fasting for the determination of blood glucose, lead, zinc, copper and chromium. Fasting blood sugar (FBS) was determined by glucose oxidase-peroxidase assay to confirm the status of the patients and the controls while metalsrsquo; concentrations were measured with Atomic Absorption Spectrometer (AAS). The mean FBS concentrations of the diabetic group were significantly higher (plt;0.05, plt;0.05 respectively) than those of the control group. Similarly, the mean blood lead levels of the diabetic male and female patients were 49.40 plusmn; 14.36 and 46.30 plusmn; 15.22 g/dL respectively and significantly higher (plt;0.05, plt;0.05respectivelly) than those of control males and females (38.07 plusmn; 14.00 and 35.51 plusmn; 13.00 g/dL respectively). Additionally, a positive relationship was observed between the concentrations of FBS and lead (r = 0.393; plt;0.01). These findings in this study revealed that lead has an interactive connection with type 2 diabetes mellitus while zinc, copper and chromium have no such significant relationships with the disease. Key words: Diabetes mellitus, lead, fasting blood sugar, trace elements. Academic Journals 2007 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/91692679859 http://dx.doi.org/10.5897/AJBR.9000222 en Copyright © 2007 Babalola O. O, Ojo L. O and Akinleye A.O

oai:academicjournals.org:AJBR:126C82F9869 2007-12-31T00:00:00Z AcademicJournals AJBR AJBR:2007

Molecular studies on the immobility of genomic construction in the random mating population A.E.Elkomy, Hanan.H.Ghanem and Elsayed E. Hafez Full Length Research Paper Random population studies are very important to estimate the environmental factors in nutritional, physiological and breeding experiments. Studying the quantitative traits, consisting of genetic, environmental factors and interaction between them is very important as well. In a random population study, the genetic variation for 50 chicken individuals (Mandarah strain) of three successive generations was examined using differential display technique. The difference between the generations was measured by the change of DNA frequencies for the random population. Age at sexual maturity was changed during the three generations, but these differences were not significant. The body weight at sexual maturity (BWSM) of the 2nd and the 3rd generations was decreased significantly compared with the 1st generation. Whenever this decrease was not frequent, although, the egg number (EN), egg mass (EM) and rate of laying (RL) were not constant over generations, differences between the generations were highly significant for EN and EM only. In addition, comparative analysis based on the molecular levels and genotype stability clarified the genetic variations between the examined groups (females or males). Eleven bands with different molecular weights were observed in case of females in comparison to only 9 bands in case of the males. Phylogenetic studies revealed that, there was a genetic variability between females of the 1st generation. Furthermore, low level of similarity was observed between the 2nd generation in respect to the 1st and 3rd generations. Genetic similarity between females and males of the 2nd and the 3rd generations was 55%. It could be concluded that the differences in egg production trait, which was found among generations, may be due to indirect or natural selection. Key words: Differential display, random mating, chicken and random population. Academic Journals 2007 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/126C82F9869 http://dx.doi.org/10.5897/AJBR.9000168 en Copyright © 2007 A.E.Elkomy, Hanan.H.Ghanem and Elsayed E. Hafez

oai:academicjournals.org:AJBR:585BEBB9882 2007-12-31T00:00:00Z AcademicJournals AJBR AJBR:2007

Phenolic content and phospholipids peroxidation inhibition by methanolic extracts of two medicinal plants: Elionurus muticus and Hypoxis hemerocallidea Dzingirai, B. , Muchuweti, M , Murenje, T., Chidewe, C., Benhura, M.A.N and Chagonda, L. S. Full Length Research Paper Two commonly known medicinal plants from Zimbabwe were analyzed for total phenolic content, superoxide radical scavenging activity and the ability to inhibit lipid peroxidation in rat brain extracts. The plant samples used in this study were Elionurus muticus and Hypoxis hemerocallidea. The Folin Ciocalteu method was used to determine the total phenolic content. The total phenolic content was high in H. hemerocallidea which had 0.268 plusmn; 0.02 mg/100mg dry mass of plant extract and lowest in E. muticus root extract had 0.041 plusmn; 0.03 mg/100mg dry mass of plant extract. The scavenging activities on the superoxide ion of the plant extracts was dose dependent with maximum scavenging activity being obtained from E. muticus whole plant (69.12% plusmn; 0.12 at 80 mg/ml) and the least activity were detected in H. hemerocallidea(52.92% plusmn; 0.95 at 80 mg/ml). The plant extracts also gave a dose dependent protection against lipid peroxidation in rat brain homogenate with the highest protection detected from E. muticus whole plant and the least from H. hemerocallidea. Key words: Phenolic compounds, Medicinal plants, Phospholipid peroxidation. Academic Journals 2007 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/585BEBB9882 http://dx.doi.org/10.5897/AJBR.9000184 en Copyright © 2007 Dzingirai, B. , Muchuweti, M , Murenje, T., Chidewe, C., Benhura, M.A.N and Chagonda, L. S.

oai:academicjournals.org:AJBR:28A55F29886 2007-12-31T00:00:00Z AcademicJournals AJBR AJBR:2007

Determination of the glycemic index of steamed cakes using two different legumes 'bambara nut (Vigna subterranean) and cowpea (Vigina unguiculata)' Onimawo I. A., Ijeh I., Ukoha U. and Nwachukwu G. T. Full Length Research Paper This study was carried out to determine the blood glucose response and glycemic index of food for diabetics and non-diabetics. The subjects comprised of 10 diabetics and 7 non-diabetics. The results of the physical characteristics showed that the diabetic subjects were on the average older (age bracket between 51 and 70years) than the non-diabetics (18 and 23years). The Body mass index (BMI) values indicated that over 90% of the diabetics were obese while the non-diabetics were on the average normal. Results also showed that the blood glucose response of the diabetics were significantly higher (Plt;0.05) than that of the non- diabetics. When fed on the test diets (ldquo;okpardquo; and ldquo;moinndash;moinrdquo;), the blood glucose response was significantly reduced when compared to bread diet for both diabetics and non-diabetics. The results further indicated that the blood glucose response was better with ldquo;okpardquo; than with ldquo;moinndash;moinrdquo;, suggesting that ldquo;okpardquo; is a better diet for diabetic patients. The glycemic index values for ldquo;okpardquo; and ldquo;moinndash;moinrdquo; were 78 and 38 respectively for the non-diabetics while the values were 59 and 66 respectively, for the diabetics indicating that ldquo;okpardquo; is a better diet for the diabetics. Key words: Glycemic index, diabetics, blood glucose response, bread, okpa and moin - moin. Academic Journals 2007 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/28A55F29886 http://dx.doi.org/10.5897/AJBR.9000073 en Copyright © 2007 Onimawo I. A., Ijeh I., Ukoha U. and Nwachukwu G. T.

oai:academicjournals.org:AJBR:34FB87C9902 2007-12-31T00:00:00Z AcademicJournals AJBR AJBR:2007

Influence of Cassia auriculata flowers on insulin receptors in streptozotocin induced diabetic rats: studies on insulin binding to erythrocytes L. Pari , P. Murugan and C. Appa Rao Full Length Research Paper In this paper, we investigated the insulin-receptor-binding effect of Cassia auriculata flower extract (CFEt) in streptozotocin induced male wistar rats, using circulating erythrocytes as a model system. We measured the levels of plasma glucose and plasma insulin and the binding of insulin to cell-membrane erythrocyte receptors (ER) in CFEt and glibenclamide treated diabetic rats. The mean specific binding of insulin to ER was significantly lower in diabetic control rats than in CFEt, glibenclamide treated diabetic rats, resulting in a significant decrease in plasma insulin. Scatchard plot analysis demonstrated that the decrease in insulin binding was accounted for by a lower number of insulin receptor sites per cell in diabetic control rats when compared with CFEt treated rats. High-affinity (Kd1), low-affinity (Kd2), and kinetic analysis revealed an increase in the average receptor affinity in ER from CFEt treated diabetic rats. The results suggest an acute alteration in the number of insulin receptors on ER membranes in streptozotocin-induced diabetic control rats. Treatment with CFEt (2.40 plusmn; 0.15) improved specific insulin binding, with receptor number and affinity binding diabetic rats (0.95 plusmn; 0.06).These biochemical observations were supplemented by histopathological examination of pancreas section. The data presented here showed that CFEt increase total ER membrane insulin binding sites with a concomitant (7.08 plusmn; 0.51) increase in plasma insulin. Key words: glucose, insulin binding sites, plasma insulin, Cassia auriculata, glibenclamide. Academic Journals 2007 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/34FB87C9902 http://dx.doi.org/10.5897/AJBR.9000141 en Copyright © 2007 L. Pari , P. Murugan and C. Appa Rao

oai:academicjournals.org:AJBR:6C81B689909 2007-12-31T00:00:00Z AcademicJournals AJBR AJBR:2007

Evaluation of biochemical indices of male rat reproductive function and testicular histology in wistar rats following chronic administration of aqueous extract of Fadogia agrestis (Schweinf. Ex Heirn) stem Yakubu, M. T., Oladiji, A. T. and Akanji, M. A. Full Length Research Paper The effects of administration of aqueous extracts of Fadogia agrestis stem for 28 days and the 10 days post treatment effects on biochemical indices of reproductive function and testicular histology were evaluated in male albino rats. The rats were randomly selected into four study groups, A, B, C and D of 10 rats per group. Animals in group A (control) received 1 ml of distilled water (vehicle), and test groups B, C and D received graded doses of 18, 50, and 100 mg/kg body weight of extract respectively on daily basis for 28 days. At the end of 28 days treatment period, 5 animals were sacrificed while the remaining 5 from the same group were sacrificed after a ten day recovery period. There were significant (Plt;0.05) increases in the prostrate ndash; body weight ratio (%), citric acid concentration and acid phosphatase activity at all the dose regimen and only at 50 and 100 mg/kg body weight dose regimen for calcium and phosphate, while pH was not altered. There was no recovery on prostatic parameters except the citric acid content at 18 mg/kg body weight. Sperm count, motility, morphology and density were significantly reduced at 50 and 100 mg/kg dose regimen. The pH, colour, turbidity and viscosity of semen were unaffected but the seminal vesicular-body weight ratio (%), fructose content and glutamate dehydrogenase activity were significantly (Plt;0.05) reduced at higher doses. Histopathological changes revealed destruction of spermatic cells and seminiferous tubules. Toxicity was mild and reversible at 18 mg/kg body weight dose regimen but there was irreversible derangement on male testicular histology at 50 and 100 mg/kg body weight dose regimen, which may adversely affect reproductive function especially male fertility. Key words: Fadogia agrestis stem, prostate, seminal vesicle, sperm, oral administration, recovery, reproductive function indices, testicular histology. Academic Journals 2007 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/6C81B689909 http://dx.doi.org/10.5897/AJBR.9000117 en Copyright © 2007 Yakubu, M. T., Oladiji, A. T. and Akanji, M. A.

oai:academicjournals.org:AJBR:57ADE679193 2008-01-31T00:00:00Z AcademicJournals AJBR AJBR:2008

Gangliosides as potential inhibitors of Naja naja venom PLA2 (NV-PLA2) induced human erythrocyte membrane damage Mukunda Chethankumar and Leela Srinivas Full Length Research Paper We determined the ability of mixed gangliosides (16% GD1b, 19% GT1b, 21% GM1, and 40% GD1a) and individual gangliosides GM1 and GD1b to modulate the NV-PLA2 induced human erythrocyte ghost membrane damage. CM-Sephadex purification of crude Naja naja venom yielded eight peaks of which peak VII, a major phospholipase A2 (NV-PLA2) accounted for 22% of the total protein recovered and 8% of the total PLA2 activity recovered. The membrane damage induced by NV-PLA2 was assessed by measuring the decrease in the relative intensity of fluorescence using cisndash;parinaric acid (PnA) as a monitor molecule. The RBC membranes isolated from healthy human blood showed 72% damage on treatment with NV-PLA2 (2 mg) when compared to untreated membranes. Mixed gangliosides (18 nM) and GM1 (15 nM) offered 81 and 86% protection respectively, whereas GD1b (20 nM) did not show significant protection. Analysis of membrane bound Na+K+ and Ca2+Mg2+ ATPase indicated a 3 fold and 2 folds decrease in their activities on NV-PLA2 treatment when compared to untreated membranes. Mixed gangliosides restored the Na+K+ ATPase activity by 78%, whereas GM1 and GD1b offered 74 and 52% restoration respectively. The Ca2+Mg2+ ATPase activity was restored by 80 and 81% with mixed gangliosides and GM1 respectively. GD1b showed only 50% restoration. Mixed gangliosides and GM1 exhibited a significant dose dependent inhibition of NV-PLA2 activity when compared to GD1b. The data show that mixed gangliosides and GM1 were effective in modulating NV-PLA2induced erythrocyte membrane damage than GD1b. Key words: Gangliosides, NV-PLA2, PnA, gangliosides, erythrocyte membrane, Na+ K+ ATPase, Ca2+ Mg2+ ATPase. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/57ADE679193 http://dx.doi.org/10.5897/AJBR.9000124 en Copyright © 2008 Mukunda Chethankumar and Leela Srinivas

oai:academicjournals.org:AJBR:9296BD39203 2008-01-31T00:00:00Z AcademicJournals AJBR AJBR:2008

Trans-resveratrol as phenolic indicator of somatic embryogenesis induction in cotton (Gossypium hirsutum L.) cell suspensions Kouakou Tanoh Hilaire, , Koneacute; Mongomakeacute;, Koneacute; Daouda, Kouadio Yatty Justin, Amani Nrsquo;guessan Georges, Teacute;guo Waffo Pierre, Deacute;cendit Alain and Meacute;rillon Jean-Michel Full Length Research Paper Trans-resveratrol is a phytoalexin which was found in some grapes and in many other plants. This phenolic compound has gained much attention, as it was indicated to be associated with fungus and disease resistance. Also, it has been shown that phenols compounds could play an important role in somatic embryogenesis induction of various plants. In cotton, embryogenic structures take place in cell suspension cultures. The need of biochemical indicators for the early identification of cells capable to undergo embryogenic structures formation has always been a major concern of researchers. Trans-resveratrol was found only in embryogenic cell suspensions of Coker 312. This phenolic compound started at the first subculture (2.44 g/g dw) and the maximum level was reached at the third subculture (7.2 g/g dw) with an increase of nearly 295%. This study showed a correlation between trans-resveratrol synthesis in cotton cell and embryogenic structures induction. trans-resveratrol may be a phenolic indicator for is induction of cotton somatic embryogenesis. Key words: Trans-resveratrol, suspension culture, embryogenic structures, cotton, Gossypium hirsutum L. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/9296BD39203 http://dx.doi.org/10.5897/AJBR.9000255 en Copyright © 2008 Kouakou Tanoh Hilaire, , Koneacute; Mongomakeacute;, Koneacute; Daouda, Kouadio Yatty Justin, Amani Nrsquo;guessan Georges, Teacute;guo Waffo Pierre, Deacute;cendit Alain and Meacute;rillon Jean-Michel

oai:academicjournals.org:AJBR:A39CF9B9208 2008-01-31T00:00:00Z AcademicJournals AJBR AJBR:2008

Allethrin-induced biochemical changes and properties of human erythrocyte membrane Narendra M., Kavitha G., Padmavathi P., Helah Kiranmai A. and Varadacharyulu N. C. Full Length Research Paper Erythrocyte membranes from twelve human volunteers exposed regularly to allethrin, a mosquito repellent of type-I pyrethroid, were analyzed for cholesterol (C), phospholipids (P), and individual phospholipid classes to assess changes induced by this toxicant. A decrease in C and P moieties with no change in C: P ratio was observed with allethrin exposure. A significant reduction in the amount of phosphotidyl serine (PS) was noticed indicating that PS is an allethrin sensitive phospholipid species. Furthermore, decreased red cell membrane lipid peroxidation (LPO) and with no change in osmotic haemolysis of erythrocyte was observed. Increased plasma and red cell nitrate and nitrite were evident suggesting that the bioavailability of nitric oxide may have rendered tolerance to erythrocyte membrane by protecting the cell from haemolysis and oxidative damage due to its free radical scavenging and antioxidant effects. Keywords: Allethrin, nitric oxide, osmotic haemolysis, phosphatidyl serine, rbc biochemical changes. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/A39CF9B9208 http://dx.doi.org/10.5897/AJBR.9000015 en Copyright © 2008 Narendra M., Kavitha G., Padmavathi P., Helah Kiranmai A. and Varadacharyulu N. C.

oai:academicjournals.org:AJBR:B9C21A89221 2008-01-31T00:00:00Z AcademicJournals AJBR AJBR:2008

Aeration as a factor in textile dye bioremoval by Aspergillus niger Wafaa M. Abd El-Rahim, Ola Ahmed M. El-Ardy and Hassan Moawad Full Length Research Paper Experiments were done to study the bioremoval/ biosorption of dis-azo dye byAspergillus niger strain 20 in two concentrations using 5 liter bioreactor at five aeration rates. The experimental results are compared for various operating conditions. The dye used was direct brown and the inlet air flow rate was: 1/8, frac14;, frac12;, 1, 2 v/v/min. The aeration rate of frac12; v/v/min yielded 9.2 g fungal biomass and removed 72 % of the dye. Increasing of the aeration rate to 2 v/v/min increased the removal to 77%, whereas the biomass was decreased markedly at the end of the incubation time. The results also indicate that the fungal biomass obtained at the three other air flow rates was more or less the same after 3 days of incubation. The obtained results indicate that air flow rates 1/8, frac14; and frac12; v/v/min gave better dye bioremoval as compared with the high aeration rate (1, 2 v/v/min) and can be recommended for dis-azo dye bioremediation. Isotherm experiments were conducted to determine the sorbents-desorption behavior of examined dye from aqueous solutions using Langmiur and Freundlich equations. Key words: Textile dyes, removing, dis-azo, batch reactor, modeling, bioremediation. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/B9C21A89221 http://dx.doi.org/10.5897/AJBR.9000013 en Copyright © 2008 Wafaa M. Abd El-Rahim, Ola Ahmed M. El-Ardy and Hassan Moawad

oai:academicjournals.org:AJBR:DE2B0F49185 2008-01-31T00:00:00Z AcademicJournals AJBR AJBR:2008

Effects of lipids and (n-3) highly unsaturated fatty acids compositions of three artificial foods on survival, growth and body composition of common dentex’s fingerlings (Dentex dentex, L) Ali Ait Ali, Nadia Rharbi, Azeddine Abrehouche and Hassan Nhhala Full Length Research Paper Dentex juveniles of initial live weight 5 - 6 g and 108 days old after hatching, were fed three different diets for ten weeks (moist pellet (MP), imported dry pellet (IDP) and locally dry pellet (LDP)) containing three different lipid levels (26, 21 and 10% respectively) and crude protein levels (46, 45 and 47% respectively). Fatty acid composition showed that, DHA and EPA contents of moist pellet are higher than those of imported and locally dry pellets. DHA/EPA ratios of muscle were of 1.04 plusmn; 0.00 (MP), 1.48 plusmn; 0.57 (IDP) and 0.72 plusmn; 0.05 (LDP). They increased in fact during feeding period for both the three tested diets while musclersquo;s EPA content decreased compared with its initial state when beginning this experiment. Obtained specific growth rate (SGR) by weight were 1.7, 2.4 and 2.7% and food conversion rate (FCR) were 1.8, 1.3 and 1.5 respectively for MP, IDP and LDP. While survival did not show significant difference (Pgt;0.05), the best growth performance was observed using IDP and LDP as fish fed diets containing 47/10 and 45/21 protein/lipid ratios. Key words: Dentex dentex, fingerlings, lipids, (n-3) HUFA, survival, growth. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/DE2B0F49185 http://dx.doi.org/10.5897/AJBR.9000104 en Copyright © 2008 Ali Ait Ali, Nadia Rharbi, Azeddine Abrehouche and Hassan Nhhala

oai:academicjournals.org:AJBR:EDE85BB9240 2008-02-28T00:00:00Z AcademicJournals AJBR AJBR:2008

Mineral and phytochemical contents in leaves of Amaranthus hybridus L and Solanum nigrum L. subjected to different processing methods Akubugwo I. E, Obasi N. A, Chinyere G. C and Ugbogu A. E Full Length Research Paper Mineral and phytochemical contents of leaves of Amaranthus hybridus L. andSolanum nigrum L. Subjected to different processing methods were evaluated. Processing procedures adopted include shredding, sunndash;drying, ovenndash;drying, steaming and a combination of these. Minerals examined are Na, K, Ca, Mg, Fe, P, and Zn while the phytochemicals are alkaloids, flavonoids, hydrocyanic acid, phenols, phytic acid and tannins. Oven ndash; drying was the most effective method for retaining the studied minerals in S. nigrum but only for Na, Ca, Fe and Mg in A.hybridus L. Na/K and Ca/P ratios ranged between 0.13 ndash; 0.14 and 1.24 - 1.28 A.hybridus L. while values for S. nigrum L. were 0.70 ndash; 0.80 and 0.21 ndash; 0.24 respectively in all the treatments. Sunndash;drying was the most effective method for retaining the phytochemicals. For retention of alkaloids, flavonoids and saponins, ovenndash;drying proved the second best method while steaming with sun ndash; drying elicited the greatest reduction in the levels of hydrocyanic acid, phenols, phytic acid and tannins. Processing methods employed when utilizing these leaves should therefore reflect the desired effect. Key words: A. hybridus L., S. nigrum L., processing, minerals, phytochemicals. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/EDE85BB9240 http://dx.doi.org/10.5897/AJBR.9000164 en Copyright © 2008 Akubugwo I. E, Obasi N. A, Chinyere G. C and Ugbogu A. E

oai:academicjournals.org:AJBR:33CB5D79250 2008-02-28T00:00:00Z AcademicJournals AJBR AJBR:2008

Trypanocidal potential of methanolic extract of Bridelia ferruginea benth bark in Rattus novergicus J. T. Ekanem, O. M. Kolawole, O. C. Abbah Full Length Research Paper Full Length Research Paper Trypanocidal potential of methanolic extract of Bridelia ferruginea benth bark in Rattus novergicus J. T. Ekanem1, *O. M. Kolawole2, O. C. Abbah1 1Department of Biochemistry, Faculty of Basic Health Sciences, University of Uyo, Uyo, Nigeria. 2Department of Microbiology, University of Ilorin, Ilorin, Nigeria. *Corresponding author. E-mail: tomak74@yahoo.com. Tel: 2348060088495. Accepted 8 February 2008 Abstract An in vivo study of the trypanocidal potential of Bridelia ferruginea benth bark was investigated to determine its possible use against African sleeping sickness. Phytochemical screening revealed the presence of alkaloids, tannins, saponins, steroids and phlobatanins. Four groups of male albino rats weighing 220-250 g were used. The groups included the control, infected-untreated, uninfected-treated, and infected-treated. A daily dose of 20 mg/Kg body weight methanolic extract ofB. ferruginea benth bark was administered intraperitoneally at 72 h post-infection with Trypanosoma brucei brucei and parasitaemia was monitored daily. A continuous rise in parasite count was observed in the infected-untreated group. The infected-treated group showed a progressively lowered parasitamia on Days 5 to 8 post-infection, with percentage parasite reduction between 11 and 76%. Treatment also extended the lifespan for 2 days. Results also showed that treatment significantly ameliorated heamatological parameters that were studied. We suggest that methanolic extract of B. ferruginea benth bark can be useful in the management of African sleeping sickness. Key words: Bridelia ferruginea benth bark, Trypanosoma brucei, sleeping sickness, management. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/33CB5D79250 http://dx.doi.org/10.5897/AJBR.9000256 en Copyright © 2008 J. T. Ekanem, O. M. Kolawole, O. C. Abbah

oai:academicjournals.org:AJBR:E14AE039260 2008-02-28T00:00:00Z AcademicJournals AJBR AJBR:2008

Antihepatotoxic potential of Sargassum polycystum (Phaeophyceae) on antioxidant defense status in D-galactosamine-induced hepatitis in rats B. Meena, R. Anbin Ezhilan, R. Rajesh, A. Sheik Hussain, B. Ganesan, R. Anandan Full Length Research Paper We have examined the protective effect of ethanol extract of Sargassum polycystum on hepatic antioxidant status in D-galactosamine-induced hepatitis in rats. Levels of diagnostic marker enzymes [alanine aminotransferase (ALT), aspartate aminotransferase (AST), lactate dehydrogenase (LDH) and creatine phosphokinase (CPK)] in plasma, lipid peroxides, reduced glutathione and the activities of glutathione dependent antioxidant enzymes [glutathione peroxidase (GPx) and glutathione-S-transferase (GST)] and antiperoxidative enzymes [catalase (CAT) and superoxide dismutase (SOD)] in the liver tissue were determined. Prior oral administration of S. polycystum extract [125mg/kg bodyweight/day for 15 days] considerably (Plt;0.05) attenuated the D-galactosamine-induced increases in the levels of diagnostic marker enzymes in plasma of experimental rats. It also demonstrated an antioxidant activity against D-galactosamine-induced hepatitis by inhibiting the stimulation of lipid peroxidation and by preserving the hepatic enzymatic and non-enzymatic antioxidant defense system at near normal. The antihepatotoxic potential of S. polycystum might be related to its antioxidant property and membrane stabilizing action. Key words: Sargassum polycystum, D-galactosamine-induced hepatitis, diagnostic marker enzymes, lipid peroxidation, antioxidant enzymes Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/E14AE039260 http://dx.doi.org/10.5897/AJBR.9000030 en Copyright © 2008 B. Meena, R. Anbin Ezhilan, R. Rajesh, A. Sheik Hussain, B. Ganesan, R. Anandan

oai:academicjournals.org:AJBR:3FF10D79270 2008-02-28T00:00:00Z AcademicJournals AJBR AJBR:2008

Relationship between somatic cell counts, dairy cattle milk yield and composition in Burkina Faso Oueacute;draogo G. A, Millogo V, Anago-Sidibeacute; A. G and Kanweacute; B. A Full Length Research Paper The study was carried out on ten local dairy cows called Zebu at a research centre located in the west part of Burkina Faso. Dairy cows were supplemented 53.8 MJ metabolized energy and 735.7 g Crude Protein and were free access to natural pasture. Milk yield recording and individual milk sample collection took place within one month. Milk samples were analyzed for composition with the method of mid infrared spectroscopy and for somatic cell count with fluorescent method. The results showed that saleable milk yield varied between dairy cows and days. The lowest milk yield (1.04 plusmn; 0.29 L/day) was associated to higher somatic cell count (5.30 plusmn; 0.73 = Log10) compare to cows with the highest daily milk yield in this study (3.46 plusmn; 0.39 litres/day and 4.73 plusmn; 0.45 = Log10). But, the higher fat content (5.79 plusmn; 1.62) was found for cow with higher somatic cell count. Saleable milk yield and milk composition were strongly associated to somatic cell count but the study did not show how much milk and its components could vary with higher somatic cell count. Key words: Local cow, milk yield, Somatic cell count, composition. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/3FF10D79270 http://dx.doi.org/10.5897/AJBR.9000207 en Copyright © 2008 Oueacute;draogo G. A, Millogo V, Anago-Sidibeacute; A. G and Kanweacute; B. A

oai:academicjournals.org:AJBR:5BC3F369277 2008-02-28T00:00:00Z AcademicJournals AJBR AJBR:2008

Hepatoprotective activity of Bi - herbal ethanolic extract on CCl4 induced hepatic damage in rats Samudram P., Rajeshwari Hari, Vasuki R., Geetha A. and Sathiya Moorthi P. Full Length Research Paper The combined hepatoprotective effect of Bi- herbal ethanolic extract (BHEE) was evaluated against carbon tetra chloride (CCl4) induced hepatic damage in rats. Ethanolic extract from the leaves of Eclipta alba and seeds of Piper longum at a dose level of 50 mg/kg body weight was administered orally daily once for 14 days. The substantially elevated serum marker enzymes such as SGOT, SGPT, ALP, LDH, ACP, gGT and 5rsquo; Nucleotidase, due to CCl4 treatment were restored towards normalization. The biochemical parameters like total protein, total bilirubin, total cholesterol, triglycerides, and urea were also restored towards normal levels. In addition, BHEE significantly decreased the liver weight of CCl4 intoxicated rats. Silymarin at a dose level of 50 mg/kg was used as a standard reference also exhibited significant hepatoprotective activity against CCl4 induced hepatotoxicity. The results of this study strongly indicate that BHEE has got a potent hepatoprotective action against CCl4 induced hepatic damage in rats. Key words: Hepatoprotective, marker enzymes, Bi-herbal ethanolic extract, carbon tetra chloride. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/5BC3F369277 http://dx.doi.org/10.5897/AJBR.9000129 en Copyright © 2008 Samudram P., Rajeshwari Hari, Vasuki R., Geetha A. and Sathiya Moorthi P.

oai:academicjournals.org:AJBR:6E30BA09947 2008-03-31T00:00:00Z AcademicJournals AJBR AJBR:2008

RNA interference: a pathway to drug target identification and validation in trypanosome Owino, A. Vincent. , , Masiga, K. Daniel , Limo, K. Moses. Review RNA interference (RNAi) is a phenomenon through which double stranded RNA (dsRNA) induces potent sequence-specific degradation of homologous transcripts. Besides its function in cellular defense and developmental regulation, it has emerged as an invaluable tool for elucidation of gene function and drug target validation. This is particularly useful when substantial genome sequence data are available. Gene silencing using RNAi can aid translation of raw genomic sequence data into biologically relevant information toward the development of new and/or improved control strategies. Here, we review the current status of RNAi in trypanosome research focusing on challenges involved in the utilization of the technique as well as its potential application in drug target discovery and validation. Key words: RNA interference, trypanosomes, gene silencing, RNAi library, drug targets Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/6E30BA09947 http://dx.doi.org/10.5897/AJBR.9000209 en Copyright © 2008 Owino, A. Vincent. , , Masiga, K. Daniel , Limo, K. Moses.

oai:academicjournals.org:AJBR:87E44779961 2008-03-31T00:00:00Z AcademicJournals AJBR AJBR:2008

Study of the immunomodulatory and anti-inflammatory effects of evening primrose oil in adjuvant arthritis Manal F. Ismail, Shohda A. El-Maraghy, Nermin A.H. Sadik Full Length Research Paper The present study was carried out to evaluate the anti-arthritic nature of evening primrose oil (EPO) rich in gamma;-linolenic acid (GLA), on adjuvant-induced arthritic rats. Results were compared to those of diclofenac sodium, a reference standard non-steroidal anti-inflammatory drug. Arthritis was induced by subcutaneous injection of complete Freundrsquo;s adjuvant (CFA) in the right hind paw of male Wistar rats. EPO (5 g/kg b.w.) was orally administered from day 0 till day 28, while diclofenac sodium (5 mg/kg b.w.) was orally given from day 10 to day 28 after adjuvant injection. In the arthritic group, the results revealed significant decrease in body weight together with increased spleen weight, increase in serum immunoglobulin G (IgG), immunoglobulin M (IgM) and tumor necrosis factor-alpha; (TNF-alpha;) levels whereas serum interleukin-4 (IL-4) level was decreased. Serum N-acetyl-beta;-D-glucosaminidase (NAG) and beta;-glucuronidase enzyme activities were also elevated. Splenic antioxidant status was suppressed as manifested by increased malondialdehyde (MDA) level, decreased glutathione (GSH) content along with decreased enzymatic activity of glutathione peroxidase (GSHPx), glutathione reductase (GR) and glutathione-S-transferase (GST). Moreover, the splenic activity of the pathophysiological enzymes, gamma;-glutamyltransferase (gamma;-GT) and lactate dehydrogenase (LDH) was enhanced. Oral administration of EPO exerted a significant elevation in serum IgG and IgM levels. In addition, normalization of body weight, serum IL-4 and TNF-alpha; levels together with serum NAG, beta;-glucuronidase and splenic LDH enzyme activities were observed. It could be suggested that administration of plant oils rich in GLA may provide a way to modulate the inflammatory response through alteration of certain inflammatory indices. Key words: Adjuvant-induced arthritis, evening primrose oil, immunoglobulins, IL- 4, TNF-alpha;, rat. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/87E44779961 http://dx.doi.org/10.5897/AJBR.9000226 en Copyright © 2008 Manal F. Ismail, Shohda A. El-Maraghy, Nermin A.H. Sadik

oai:academicjournals.org:AJBR:66CB55F9973 2008-03-31T00:00:00Z AcademicJournals AJBR AJBR:2008

Diethylnitrosamine-induced hepatocarcinogenesis in rats: possible chemoprevention by blueberries Nermin A.H. Sadik, Shohda A. EL-Maraghy and Manal F. Ismail Full Length Research Paper Nitrosamine compounds are known hepatic carcinogens. This study was designed to study the efficacy of dietary supplementation with blueberries (BB) on diethylnitrosamine (DEN)-initiated hepatocarcinogenesis in male wistar rats. Rats were divided into three groups. The first group served as normal control group, the second group received DEN at a dose of 10 mg/kg body weight five times a week for 15 weeks. The third one received DEN as in DEN-treated group simultaneously with 4% BB-supplemented diet. The results showed that BB caused significant decrease in the elevated serum levels of alpha;-fetoprotein (AFP), homocysteine (Hcy) along with levels of glutathione(GSH), deoxyribonucleic acid (DNA), ribonucleic acid (RNA)and activity of glutathione reductase (GR) in liver. Normalization of elevated alpha;2-macroglobulin (alpha;2M) and total antioxidant capacity (TAC) levels in serum, hepatic glutathione-S-transferase (GST), glutathione peroxidase (GPx) activities and liver weight was achieved whereas body weight was significantly decreased. Moreover, no significant change was observed in elevated relative liver weight, hepatic glucose-6-P-dehydrogenase (G6PD), lactate dehydrogenase (LDH) along with serum aminotransferases, alkaline phosphatase (ALP) and gamma;-glutamyltransferase (gamma;-GT) activities. Significant increase in reduced hepatic activity of xanthine oxidase (XO) was achieved and histopathological damage was minimized in BB-treated group. It is suggested that BB suppress DEN- induced hepatocarcinogenesis and could be developed as a promising chemopreventive natural supplement for liver cancer. Key words: Blueberries, diethylnitrosamine, hepatocarcinogenesis, alpha;2-macroglobulin, alpha;-fetoprotein, homocysteine, glutathione, rats. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/66CB55F9973 http://dx.doi.org/10.5897/AJBR.9000075 en Copyright © 2008 Nermin A.H. Sadik, Shohda A. EL-Maraghy and Manal F. Ismail

oai:academicjournals.org:AJBR:7197E489983 2008-03-31T00:00:00Z AcademicJournals AJBR AJBR:2008

Effects of intraperitoneal administration of vitamins C and E or A and E combinations on the severity of Trypanosoma brucei brucei infection in rats Umar, I. A. Rumah, B. L., Bulus, S. L., Kamla, A. A., Jobin, A., Asueliman, B. I., Mazai, M.H., Ibrahim, M. A. and Isah, S. Full Length Research Paper The effects of intraperitoneal administration of combinations of vitamins C and E (100mg/Kg b.w each) or vitamins A and E (10,000i.u/Kg, 100mg/Kg b. w., respectively) on Trypanosoma brucei brucei infection in rats were compared. The rats were infected intraperitoneally with the same parasite load and the experiment lasted for 17 days. The two vitamin combinations significantly (Plt;0.05) and persistently kept the parasitaemia lower than was recorded in the untreated infected rats. Terminal parasitaemia of the infected group given the vitamins A and E combination (AE) was significantly (Plt;0.05) lower than that of the group given the vitamins C and E combination (CE). Although all infected animals developed anaemia, its severity in the untreated infected animals was significantly (Plt;0.05) higher than observed in the two infected groups treated with the vitamin combinations; with the group given AE developing a significantly (Plt;0.05) less severe anaemia than those given CE. Trypanosoma brucei infection, without vitamin treatment caused general increases in serum alanine- and aspartate aminotransferases, urea and creatinine. Although CE had no significant effect on the infection levels of serum ALT and AST; AE significantly (Plt;0.05) prevented the disease-induced increases in these parameters. The two vitamin combinations prevented, to a significant degree, the disease-induced elevation of serum urea and creatinine; however, AE was more effective at this than CE. It was concluded that intraperitoneal administration of either vitamins C and E or vitamins A and E combinations alleviates the degenerative changes in tissues and organs associated with Trypanosoma brucei infection of rats; with the vitamins A and E combination being more effective. Key words: Trypanosoma brucei brucei, antioxidant vitamins, anaemia, tissue damage. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/7197E489983 http://dx.doi.org/10.5897/AJBR.9000101 en Copyright © 2008 Umar, I. A. Rumah, B. L., Bulus, S. L., Kamla, A. A., Jobin, A., Asueliman, B. I., Mazai, M.H., Ibrahim, M. A. and Isah, S.

oai:academicjournals.org:AJBR:E5E62B710011 2008-04-30T00:00:00Z AcademicJournals AJBR AJBR:2008

Oxidative injury and enzymic antioxidant misbalance in schizophrenics with positive, negative and cognitive symptoms Uma Devi P and Chinnaswamy P Full Length Research Paper With its hallucinations, delusions, thought disorder, and cognitive deficits, schizophrenia affects the most basic human processes of perception, emotion, and judgment. Evidence increasingly suggests that schizophrenia is a subtle disorder of brain development and plasticity and oxidative injury contributes largely to pathophysiology of schizophrenia, indicated by the increased lipid peroxidation products in plasma and altered levels of enzymatic antioxidants in schizophrenic patients. However, the status of antioxidants and the extent of lipid peroxidation in erythrocytes have not been investigated so far in schizophrenia patients with different symptoms. In the present study, in order to examine the antioxidant status and lipid peroxidation in the schizophrenics with positive, negative and cognitive symptoms, the activities of three free radical scavenging enzymes glutathione transferase (GST), glucose-6-phosphate dehydrogenase (G6PD), ceruloplasmin ferroxidase (Cp) and the level of thiobarbituric acid-reactive substances (TBARS) as an index of lipid peroxidation were analyzed. Results showed that there was a significant increase in GST activity in all the schizophrenics when compared to normal and it was observed that there was a significant decrease in erythrocyte, G6PD and ceruloplasmin ferroxidase levels in patients with schizophrenia, when compared to controls. Schizophrenics with positive symptomology were found to have pronounced decrease in the activities of Cp ferroxidase and statistically more significant decrease in G6PD levels were found in patients with negative symptoms. Further a significant rise in oxidative stress and decreased secondary enzymic antioxidant status was observed in the chronic stage of schizophrenics as compared to those in acute condition. The study showed that the level of malondialdehyde was increased in schizophrenics with positive (163%), negative (137%) and cognitive (132%) symptoms compared to control groups .The increased activities of antioxidant enzymes may be a compensatory regulation in response to increased oxidative stress. The decreased concentrations of the antioxidants status support the hypothesis that lipid peroxidation is an important causative factor in the pathogenesis of schizophrenia. These data reveal that antioxidant defense mechanisms might be impaired in schizophrenic patients. Understanding these basic pathologic processes may yield novel targets for the development of more effective treatments. Keywords: Schizophrenia, symptoms, secondary antioxidant enzymes, malondialdehyde (MDA), oxidative stress Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/E5E62B710011 http://dx.doi.org/10.5897/AJBR.9000181 en Copyright © 2008 Uma Devi P and Chinnaswamy P

oai:academicjournals.org:AJBR:E63CB3210016 2008-04-30T00:00:00Z AcademicJournals AJBR AJBR:2008

Characterization of phospholipase A2 (PLA2) from Echis ocellatus venom Sallau, A. B., Ibrahim, M. A., Salihu, A. and Patrick, F. U. Full Length Research Paper Phospholipase A2 (EC. 3.1.1.4) was isolated and partially characterized from the venom of Echis ocellatus. The enzyme was purified 13.5-fold with a yield of 86.69% on DEAE-Sephadex G-75 column. The PLA2 from E. ocellatus venom had broad pH and temperature ranges with optima of 7.5 and 40oC respectively. Initial velocity studies for the determination of kinetic constants with L-alpha;- lecithin as substrate revealed a Km and Vmax of 1mg/ml and 0.35 mmoles/min respectively. The enzyme activity was enhanced by Ca2+ and strongly inhibited by Mg2+ and Co2+. Cu2+ was fairly inhibitory to the enzyme. The relevance of these findings towards understanding the biochemistry of E. ocellatus envenomation and development of antivenom for E. ocellatus venom is discussed. Key words: Echis ocellatus, PLA2, venom. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/E63CB3210016 http://dx.doi.org/10.5897/AJBR.9000057 en Copyright © 2008 Sallau, A. B., Ibrahim, M. A., Salihu, A. and Patrick, F. U.

oai:academicjournals.org:AJBR:FF0DF9010021 2008-04-30T00:00:00Z AcademicJournals AJBR AJBR:2008

Decreased cardiovascular risk and resistance to hyperlipemia-induced hepatic damage in rats by aqueous extract of Urtica dioica Alisi C. S, Emejulu A. A, Alisi P. N. C, Nwaogu L. A and Onyema O. O Full Length Research Paper Hyperlipemia and Hepatic metabolism was studied in hyperlipemic albino rats maintained on a high fat diet. Aqueous extract (100, 200, 300mg/kg/day) of Urtica dioica corrected dyslipidemia and restored hepatic chemistry in hyperlipemic animals. The extract was effective in normalizing the atherogenic lipoprotein phenotype. Total cholesterol (CHOL), Triglyceride (TG), Low density lipoprotein cholesterol (LDL), LDL/HDL-ratio, and Total Non-HDL cholesterol (TNH-CHOL) were significantly reduced by the treatment. There was no significant effect of treatment with extract on the high density lipoprotein cholesterol (HDL). Hyperlipemia was associated with significant elevations in serum liver enzymes (ALT, AST, LDH, and gamma;-GT) activities that are markers of altered hepatic chemistry. These elevations were however normalized by treatment with the extract. Hyperlipemia also induced a significant increase in bilirubin levels, decrease in total protein and decrease in albumin levels. These alterations in hepatic chemistry were normalized by treatment with U. dioica at aqueous extract concentration of 300 mg/kg. The study shows that aqueous extract of U. dioica may restore lipemic normalcy, and may posses a potential for reduction of cardiovascular risk and a resistance to hyperlipemia-induced hepatic damage in rats. Keywords: Urtica Dioica, hyperlipemia, hepatic chemistry, cardiovascular risk, rats. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/FF0DF9010021 http://dx.doi.org/10.5897/AJBR.9000070 en Copyright © 2008 Alisi C. S, Emejulu A. A, Alisi P. N. C, Nwaogu L. A and Onyema O. O

oai:academicjournals.org:AJBR:7431B0F10043 2008-05-31T00:00:00Z AcademicJournals AJBR AJBR:2008

Hepatotoxic and hemolytic effects of acute exposure of rats to artesunate overdose Omotuyi I. O, Nwangwu S. C, Okugbo O. T, Okoye O. T, Ojieh G. C and Wogu D.M Full Length Research Paper Hepatotoxic and hemolytic effects of artesunate overdose were examined in rats. Forty (40) rats were grouped randomly into four designated as A, B, C, and D. and were given oral administration of artesunate as follows: 0 mg/kg (control), 1 mg/kg (Under-dose), 2 mg/kg (Normal dose) and 4 mg/kg (Overdose) respectively. The administration was continued for 5 days. Hepatotoxicity was monitored in the rats as a function of changes in serum levels of aspartate transaminase (AST), alanine transaminase (ALT), alkaline phosphatase (ALP), total serum albumin and malondiadehyde (MDA) level. The hemolytic effect of this drug was monitored by changes in the packed cell volume (PCV), total bilirubin, conjugated bilirubin and malondiadehyde (MDA) levels of erythrocyte. For group D (overdose group) subjects when compared with the control (group A), there was significant (plt;0.05) decrease in serum albumin and hematocrit, but significant increase in serum levels of total bilirubin, and conjugated bilirubin. An increased hepatocyte and erythrocyte malondiadehyde level was also observed in group D. The result also shows increased activities for the serum enzymes in all the groups when compared with control group but significant increase was recorded for groups C and D. There is a clear indication that hepatotoxicity and hemotoxicity are associated with artesunate administration at both required and overdose conditions however these effects are magnified in overdose conditions. Key words: Artesunate, hepatotoxicity, hemotoxicity, serum enzymes, bilirubin, malondialdehyde. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/7431B0F10043 http://dx.doi.org/10.5897/AJBR.9000133 en Copyright © 2008 Omotuyi I. O, Nwangwu S. C, Okugbo O. T, Okoye O. T, Ojieh G. C and Wogu D.M

oai:academicjournals.org:AJBR:66ED38810047 2008-05-31T00:00:00Z AcademicJournals AJBR AJBR:2008

Effect of aerobic pre-treatment on production of hydrolases and volatile fatty acids during anaerobic digestion of solid sisal leaf decortications residues Anthony Manoni Mshandete, Lovisa Bjouml;rnsson, Amelia Kajumulo Kivaisi, Mugassa Steven Thomas Rubindamayugi and Bo Mattiasson Full Length Research Paper The effect of aerobic pretreatment on the production of hydrolases and volatile fatty acids during anaerobic digestion of solid sisal decortications leaf residue (SLDR) was investigated. Batch solid waste bioreactors with working volume of 2 litres were used in this study. Batch loads of aerobically treated or untreated sisal leaf residue inoculated with activated sludge mixed culture were packed into the bioreactors and operated anaerobically for 400 h. The fermentation products were mainly (mg/g total volatile fatty acids, VFAs): acetic acid (287), n-butyric acid (201), n-valeric acid (96) and caproic acid (62) as well as with low amounts of propionic acid and iso-butyric acid for aerobic pre-treated sisal leaf waste solids. Contrarily, for the untreated system, the fermentation products were chiefly (mg/g total volatile fatty acids): propionic acid (317), iso-butyric acid (276), n-butyric acid (96), acetic acid (84) and insignificant amounts of n-valeric acid, iso-valeric acid and caproic acid. Although the activities of hydrolytic enzymes found were similar for both treated and untreated SLDR, proportions of VFAs obtained with the former residues appeared to be better substrates for biomethanantion than those obtained from the latter substrates. These results indicated the potential of aerobic pre-treatment for enhanced bioconversion of SLDR. The present study, reports for the first time the types and levels of VFAs and hydrolases produced during anaerobic digestion of aerobic pre-treated SLDR and could be used as a basis for designing a pilot scale process. Key words: Aerobic pre-treatment, hydrolases, volatile fatty acids, anaerobic digestion, sisal leaf decortications residues. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/66ED38810047 http://dx.doi.org/10.5897/AJBR.9000083 en Copyright © 2008 Anthony Manoni Mshandete, Lovisa Bjouml;rnsson, Amelia Kajumulo Kivaisi, Mugassa Steven Thomas Rubindamayugi and Bo Mattiasson

oai:academicjournals.org:AJBR:0E6A5C310053 2008-05-31T00:00:00Z AcademicJournals AJBR AJBR:2008

A comparative study on the atheroprotective potential of heparin and atorvastatin in hypercholesterolemic rats Vijayabaskar P, Sethupathy S and Somasundaram S. T Full Length Research Paper The present study is to evaluate the effect of standard drug heparin and atorvastatin on the atherogenic disturbances in hypercholesterolemic atherogenic animals. Six groups of male Wistar rats were employed in this study, of which three groups received atherogenic CCT diet (rat chow supplemented with 4% cholesterol, 1% cholic acid and 0.5% thiouracil) for 17 days. Two groups were treated with standard heparin (200 units/kg/day, s.c) and atorvastatin (1.34 mg/kg/day, oral gavage) respectively commencing from 10th day of the experimental period with the remaining group served as control. Another 3 groups received normal rat chow diet during the entire experimental period. One group received only CCT diet while the other two groups received heparin and atorvastatin respectively. Increase in the plasma levels of cholesterol, triglycerides, high density lipoprotein, very low density lipoprotein and low density lipoprotein induced by CCT diets were normalized by heparin and statin treatment. The CCT diet induced abnormal rise with the plasma hepatic marker enzymes alkaline phosphatase, alanine transaminases and aspartate transaminases, plasma urea, glucose and creatinine levels were restored to normal with the treated groups. The CCT diet induced lecithin cholesterol acyltransferase (LCAT) and lipoprotein lipase (LPL) activities were restored to normal in the treated groups. Standard heparin and atorvastatin intervention minimized the atherogenic diet induced histopathological lesions in liver, kidney and aortic tissues. Key words: CCT diet, atherosclerosis, standard heparin, atorvastatin, LCAT, LPL. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/0E6A5C310053 http://dx.doi.org/10.5897/AJBR.9000003 en Copyright © 2008 Vijayabaskar P, Sethupathy S and Somasundaram S. T

oai:academicjournals.org:AJBR:01BA58F10057 2008-06-30T00:00:00Z AcademicJournals AJBR AJBR:2008

Acid phosphatase from snail heamolymph: a cheap and convenient source of enzyme for kinetic parameters determination Femi Kayode Agboola and Adeyinka Afolayan Full Length Research Paper The study of enzymes occupies a very important position in biological, medical and industrial research. Also, the satisfactory performance of an enzyme assay provides a good introduction to biochemical techniques. This experiment presents a good introductory project to students for the estimation of the kinetic parameters of an enzyme. The spectrophotometric/colorimetric assay of acid phosphatase is very simple with a readily available substrate, p-nitrophenyl phosphate, which can easily be purchased, and other common laboratory reagents; sodium hydroxide, sodium acetate and ethylenediamine-tetraacetic acid (EDTA). The snail is cheap and the heamolymph collected required no hemolysis and/or centrifugation. The assay method does not require an additional reagent for colour development. Earlier acid phosphatase had been found to be present in a relatively high activity in the heamolymph of the giant African snail, Archachatina marginata, and is highly specific for p-nitrophenyl phosphate. Key words: Acid phosphatase, snail, Archachatina marginata, heamolymph, p-nitrophenyl phosphate. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/01BA58F10057 http://dx.doi.org/10.5897/AJBR.9000009 en Copyright © 2008 Femi Kayode Agboola and Adeyinka Afolayan

oai:academicjournals.org:AJBR:102394A10063 2008-06-30T00:00:00Z AcademicJournals AJBR AJBR:2008

Influence of nitrogen application on grain yield and end use quality in segregating generations of bread wheat (Triticum aestivum L) Bayoumi, T. Y and I. S. El- Demardash Full Length Research Paper Variation in bread making quality of wheat (Triticum aestivum L) is a major consideration for suppliers and bakers. Grain protein concentration, protein quality, ash content and carbohydrates are major quality attributes of bread wheat. Breeders and their cereal chemist colleagues use predictors of these end use quality factors in the early generations to develop improved cultivars. Six populations of bread wheat derived from a previous diallel experiment were evaluated under three rates of nitrogen fertilizer for grain yield and end use quality. Increasing nitrogen (N) rates from low (40 kg fad-1. N) to high (120 kg fad-1. N) had an accelerating significant effect on grain yield and quality in F2 and F3generations. Desirable quality types along with high grain yield were defined within the C3, C4 and C6 populations. The population C6 exhibited the highest flour protein (13.8%) and the lowest flour ash (0.42%) as well as good grain yield as compared with the check variety and other populations. In F3 populations, 1000-kernel weight was an effective selection criterion for grain yield in pop. C3, C4 and C6 but it caused reduction in flour protein in pop. C1. Grain protein concentration showed an increasing trend in F3 generation, confirming the positive relationship with grain yield. The expected response to selection of F3 populations under high N level were 8.81% for grain yield, 8.0% for flour protein 5.74% for gluten and 4.98% for carbohydrates. The SDS-PAGE of grain storage proteins was performed in order to analyze molecular weight of gluten subunits (GS) and investigate genetic diversity among the selected populations. The population C6 exhibited the highest unique bands (5 from 7 bands) under high N level and followed by the population C4. The high N level generally increased total high-molecular weight-GS content in wheat grain, although different patterns of response to N rate were observed between populations. Key words: Bread wheat, segregating populations, nitrogen, protein electrophoresis. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/102394A10063 http://dx.doi.org/10.5897/AJBR.9000142 en Copyright © 2008 Bayoumi, T. Y and I. S. El- Demardash

oai:academicjournals.org:AJBR:4B3032F10066 2008-06-30T00:00:00Z AcademicJournals AJBR AJBR:2008

Hepatoprotective effect of Cichorium intybus on CCl4-induced liver damage in rats Sadeghi Heibatollah, Nikbakht Mohammad Reza; Ghaitasi Izadpanah and Sabzali Sohailla Full Length Research Paper The purpose of this study was to evaluate the hepatoprotective activity of hydroalcholic extract of Cichorium intybus (Cichorium intybus) using a carbon tetrachloride (CCl4) - induced liver injury in rats. The leaf extract at oral dosage of 200, 400 and 500 mg/kg exhibited significant (Plt;0.05) protective effect against CCl4 induced hepatoxocity. Level of serum markers such as aspartate aminotransferase (AST), alanine aminitransferase (ALT), alkaline phosphatase (ALP), total bilirubin (TB) were significantly increased in CCl4 treated rats. Simultaneously, C. intybus extract significantly suppressed mainly the increase in plasma activities of AST, ALT, ALP and TB concentration, which are considered as markers of liver functional state. The results of this study confirmed the hepatoprotective activity effect of the hydroalcholic extract of C. intybus. Key words: Cichorium intybus, hepatoprotective activity, carbon tetrachloride, aspartate aminotransferase, alanine aminitransferase, alkaline phosphatase. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/4B3032F10066 http://dx.doi.org/10.5897/AJBR.9000130 en Copyright © 2008 Sadeghi Heibatollah, Nikbakht Mohammad Reza; Ghaitasi Izadpanah and Sabzali Sohailla

oai:academicjournals.org:AJBR:9E5A93110076 2008-07-31T00:00:00Z AcademicJournals AJBR AJBR:2008

Nitric oxide scavenging ability of ethyl acetate fraction of methanolic leaf extracts of Chromolaena odorata (Linn.) Alisi, C. S and Onyeze, G. O. C Full Length Research Paper The nitric oxide (NO.) scavenging activities of Chromolaena odorata (Linn) King and Robinson, was investigated and compared with standard Plant Phenolic antioxidant Quercetin. Disodium pentacyanonitrosyl ferrate (2- ) dihydrate (sodium nitroprusside) was used as a nitric oxide donor. On disintegration at a physiological pH (7.2), 5 mmol/l of sodium nitroprusside generated a time dependent nitric oxide concentration which was scavenged in vitro by the extract. Inhibition of nitrite formation by Ethyl Acetate Fraction of Methanolic Extract of C. odorata (EAFCO), showed a dose-dependent response. Ability of EAFCO to scavenge nitric oxide radicals in vitro was compared to a standard Plant phenolic compound (Quercetin). Quercetin and EAFCO had IC50 = 50 and 380 g/ml respectively and an IC100 of 2000 and 2800 g/ml respectively. The overall result showed that the plant C. odorata is a good nitric oxide radical scavenger. The preliminary phytochemical analysis of chromolaena odorata extracts revealed the presence of alkaloids, glycosides, flavonoids, saponins and tannins. Quantitative determination of total phenolic content shows that the EAFCO contains an appreciable amount of phenolic compounds and may be responsible for the observed potential. Key words: Chromolaena odorata, nitric oxide scavenger, ethyl acetate fraction. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/9E5A93110076 http://dx.doi.org/10.5897/AJBR.9000174 en Copyright © 2008 Alisi, C. S and Onyeze, G. O. C

oai:academicjournals.org:AJBR:82070DD10085 2008-07-31T00:00:00Z AcademicJournals AJBR AJBR:2008

Algal extracts improve antioxidant defense abilities and salt tolerance of wheat plant irrigated with sea water Hanaa H. Abd El-Baky, Hussein M. M. and Game S. El-Baroty Full Length Research Paper Effect of irrigation bread wheat plants (Triticum aestivum L., cv. Giza 94) with sea water (10 and 20% v/v), spraying with microalgae extracts obtained from Chlorella ellipoida and Spirulina maxima (5 gL-1 dry weight in 0.1% Tween solution) cultivated under normal and stress conditions were studied. Some plant bioregulators (BRGs, ascorbic acid and benzyl adenine, at 200 ppm) at the vegetative growth stage on photosynthetic pigments, antioxidant components, activity of some antioxidant enzymes, lipid peroxidation products, growth parameters, mineral content and economic yield were estimated. Irrigation of wheat plants with sea water led to an increase in Na+ ion, activities of antioxidant enzymes, superoxide dismutase, ascorbate peroxidase and total peroxidase, and TBARs components. In contrast, the contents of photosynthetic pigments and yield components were reduced. Furthermore, the overall growth of wheat plants was interrupted by irrigation with sea water (10 and 20%) and the effect was pronounced at higher level (20%). Application of BRGs had a slight effect on plant growth, antioxidant behaviour and activity of antioxidant enzymes in plants irrigation with sea water compared with that in stressed wheat plants. Application of algal extracts significantly increased the contents of total chlorophyll and antioxidant phenomenon. In additional, application of algal extracts exhibited strong positive correlation with increase in fresh weight (FW), grain weight and yield components. It is concluded that productive purpose of wheat crop by mean of brackish water (at 20 v/v level) is possible under a level of economical value through its application of algal extracts. Key words: Microalgae, sea water, wheat, salinity stress, antioxidant systems. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/82070DD10085 http://dx.doi.org/10.5897/AJBR.9000014 en Copyright © 2008 Hanaa H. Abd El-Baky, Hussein M. M. and Game S. El-Baroty

oai:academicjournals.org:AJBR:08EFC5D10115 2008-07-31T00:00:00Z AcademicJournals AJBR AJBR:2008

Effect of administration of aqueous and ethanolic extracts of Enantia chlorantha stem bark on brewer’s yeast-induced pyresis in rats Adesokan, A. A., Yakubu, M. T., Owoyele, B. V., Akanji, M. A., Soladoye, A. O. and Lawal, O. K. Full Length Research Paper The phytochemical screening of aqueous and ethanolic extracts of the stem bark of Enantia chlorantha Oliv as well as the antipyretic effect of the solvent extracts at 25, 50, 100 and 200 mg/kg body weight was investigated in albino rats. Phytochemical analysis of the aqueous and ethanolic extracts of E. chloranthastem bark revealed the presence of phenolics, flavonoids, alkaloids, glycosides and saponins. The concentrations of these phytochemicals in the ethanolic extracts were slightly higher than in the aqueous extracts. The 50 - 200 mg/kg body weight of the solvent extracts produced significant reduction (Plt;0.05) in rectal temperature of the hyperpyretic rats. The antipyretic activities of the solvent extract at these doses also compared favourably (Pgt;0.05) with the indomethacin dosed groups. This study showed that the aqueous and ethanolic extracts of E. chlorantha stem bark at 50 - 200 mg/kg body weight possess antipyretic activity and thus supports the folklore use of the plant in the management of fever. Key words: Enantia chlorantha, brewerrsquo;s yeast, antipyretic, rectal temperature. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/08EFC5D10115 http://dx.doi.org/10.5897/AJBR.9000082 en Copyright © 2008 Adesokan, A. A., Yakubu, M. T., Owoyele, B. V., Akanji, M. A., Soladoye, A. O. and Lawal, O. K.

oai:academicjournals.org:AJBR:B70275410124 2008-08-31T00:00:00Z AcademicJournals AJBR AJBR:2008

A 22-bp sequence of the core promoter from the Indica rice sucrose-phosphate synthase gene (sps1) is sufficient to confer basal transcription activity Miguel Martiacute;nez-Trujillo, Gamaliel Valdivia-Rojas, Gloria Soliacute;s Guzmaacute;n, Joseacute; Luis Cabrera-Ponce Full Length Research Paper The 5rsquo; region of the sucrose-phosphate synthase gene (sps1) of the Indica riceconsists of an atypical promoter which lacks TATA box but has a putative initiator sequence overriding a second transcription initiation site. Analysis of the transient expression of truncated versions of the sps1 promoter (from -148 to +21) fused to the uidA reporter gene was performed. The results showed that a stretch of 22 bp (GTGTCACCCGCCAGCCTCCCT), from -1 to +21, is sufficient to confer basal transcription activity. These data suggest that an initiator-like sequence (TCACCC) is the responsible of this basal activity. Key words: Core promoter, sps1 gene, expression analysis. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/B70275410124 http://dx.doi.org/10.5897/AJBR.9000002 en Copyright © 2008 Miguel Martiacute;nez-Trujillo, Gamaliel Valdivia-Rojas, Gloria Soliacute;s Guzmaacute;n, Joseacute; Luis Cabrera-Ponce

oai:academicjournals.org:AJBR:99BF1C210135 2008-08-31T00:00:00Z AcademicJournals AJBR AJBR:2008

Comparative study on the determination of assay for laccase of Trametes sp. Airong Li, Yue Zhu, Liang Xu, Wenqing Zhu and Xingjun Tian Short Communication The aim of this work was to determine the sensitivity among compounds in common use for detecting laccase activity. In this study, three assay procedures to measure laccase activity of Trametes sp. were performed in Kirkrsquo;s basal salts mediums of three dyes. In the assay methods, three substrates were employed, which were 2,2#39;-azinobis-(3-ethylbenzthiazoline-6-sulfonate) (ABTS), omicron;-dianisidine and guaiacol. The results indicate that laccase activity used ABTS as a substrate was significantly higher than the other two. Therefore, the ABTS method is recommended while detecting laccase activity. Key words: ABTS, omicron;-dianisidine, guaiacol, laccase activity, Trametes sp. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/99BF1C210135 http://dx.doi.org/10.5897/AJBR.9000064 en Copyright © 2008 Airong Li, Yue Zhu, Liang Xu, Wenqing Zhu and Xingjun Tian

oai:academicjournals.org:AJBR:C33811110128 2008-08-31T00:00:00Z AcademicJournals AJBR AJBR:2008

Nicotinamide: A cytoprotectant against streptozotocin-induced diabetic damage in Wister rat brains Safinaz S. Ibrahim and Sherine M. Rizk Full Length Research Paper Nicotinamide is being used in experimental and clinical trials examining the prevention of type-1 diabetes mellitus. However, the precise mechanisms underlying the antidiabetic and neuroprotective effects of nicotinamide require further analysis. Our goals are to evaluate the protective effect and the cellular and molecular mechanisms of nicotinamide against brain damage induced by type-1 diabetes in rats. Type-1 diabetes was induced by i.p injection of streptozotocin (50 mg/kg). Ten days after the induction of diabetes, rats were divided into two groups, control diabetic group and nicotinamide-treated group. Nicotinamide was i.p administered at daily dose of 100 mg/kg for a period of 4 weeks. Another group of normal animals was served as normal control group. The diabetic group showed a significant (p lt; 0.05) decrease in the content of brain DNA, RNA and glutathione, whereas, the contents of lipid peroxide, as malondialdehyde, and nitric oxide were significantly increased. The activities of aldose reductase, sorbitol dehydrogenase and cytochrome oxidase were significantly increased, whereas, the activities of glutathione reductase, glutathione peroxidase, glutathione-S-transferase and superoxide dismutase were significantly decreased. Nicotinamide administration produced restoration of brain malondialdehyde, nitric oxide, glutathione, RNA, DNA levels and the activities of the most measured enzymes. In conclusion, nicotinamide could ameliorate brain damage induced by type-1 diabetes in Wistar rats. The present data provide new approaches for the precise cellular and molecular mechanisms of the neuroprotective effect of nicotinamide. Key words: Nicotinamide, STZ-diabetes, rat brain, polyol pathway, oxidative status, antioxidant systems, DNA and RNA levels. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/C33811110128 http://dx.doi.org/10.5897/AJBR.9000172 en Copyright © 2008 Safinaz S. Ibrahim and Sherine M. Rizk

oai:academicjournals.org:AJBR:3A8EE2510151 2008-09-30T00:00:00Z AcademicJournals AJBR AJBR:2008

Protein profiles of adrenal gland of neonatal rat treated with monosodium glutamate Anuwat Wanthong, Sompong Thammasirirak and Khomsorn Lomthaisong Full Length Research Paper Exposure to excessive monosodium glutamate (MSG) during neonatal life has been correlated with loss of function in stress response that might be involved in changes of adrenal activity. This study was designed to investigate the protein pattern and examine the mRNA level of proteins in the adrenal glands following MSG stimulation. Neonatal rats were subcutaneously administered with MSG at a concentration of 4 mg/g body wt for 15 days and adrenal glands were collected. Analysis of 2D-PAGE of adrenal extracts demonstrated that MSG induces an increase expression of HSC70, GRP75 and GRP78. In addition, MSG treatment affected to the pI of ALDH2 to more acidic. Semi-quantitative RT-PCR showed an up-regulation of HSC70 and GRP78 transcripts in adrenal gland of MSG-treated rats, while there were no changes in GRP75 and ALDH2 mRNA levels. This study showed that administration of MSG affects on adrenal gland at both level of protein expression and gene expression differentially suggesting a complex responding process of adrenal gland to MSG stimulation. Key words: 2D-PAGE, adrenal glands, HPA axis, monosodium glutamate, proteomics Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/3A8EE2510151 http://dx.doi.org/10.5897/AJBR.9000194 en Copyright © 2008 Anuwat Wanthong, Sompong Thammasirirak and Khomsorn Lomthaisong

oai:academicjournals.org:AJBR:036529510160 2008-09-30T00:00:00Z AcademicJournals AJBR AJBR:2008

Nicotinamide: A cytoprotectant against streptozotocin-induced diabetic damage in Wister rat brains Safinaz S. Ibrahim and Sherine M. Rizk Full Length Research Paper Nicotinamide is being used in experimental and clinical trials examining the prevention of type-1 diabetes mellitus. However, the precise mechanisms underlying the antidiabetic and neuroprotective effects of nicotinamide require further analysis. Our goals are to evaluate the protective effect and the cellular and molecular mechanisms of nicotinamide against brain damage induced by type-1 diabetes in rats. Type-1 diabetes was induced by i.p injection of streptozotocin (50 mg/kg). Ten days after the induction of diabetes, rats were divided into two groups, control diabetic group and nicotinamide-treated group. Nicotinamide was i.p administered at daily dose of 100 mg/kg for a period of 4 weeks. Another group of normal animals was served as normal control group. The diabetic group showed a significant (p lt; 0.05) decrease in the content of brain DNA, RNA and glutathione, whereas, the contents of lipid peroxide, as malondialdehyde, and nitric oxide were significantly increased. The activities of aldose reductase, sorbitol dehydrogenase and cytochrome oxidase were significantly increased, whereas, the activities of glutathione reductase, glutathione peroxidase, glutathione-S-transferase and superoxide dismutase were significantly decreased. Nicotinamide administration produced restoration of brain malondialdehyde, nitric oxide, glutathione, RNA, DNA levels and the activities of the most measured enzymes. In conclusion, nicotinamide could ameliorate brain damage induced by type-1 diabetes in Wistar rats. The present data provide new approaches for the precise cellular and molecular mechanisms of the neuroprotective effect of nicotinamide. Key words: Nicotinamide, STZ-diabetes, rat brain, polyol pathway, oxidative status, antioxidant systems, DNA and RNA levels. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/036529510160 http://dx.doi.org/10.5897/AJBR.9000173 en Copyright © 2008 Safinaz S. Ibrahim and Sherine M. Rizk

oai:academicjournals.org:AJBR:DA8B70C10187 2008-10-31T00:00:00Z AcademicJournals AJBR AJBR:2008

Attenuation of N-nitrosodiethylamine-induced liver carcinogenesis in rats by naturally occurring diallyl sulfide Sherine M. Rizk and Safinaz S. Ibrahim Full Length Research Paper The present study was aimed to investigate the chemopreventive effects of diallyl sulfide (DAS), organosulfur compounds present in high amounts in garlic, against N-nitrosodiethylamine (NDEA) induced hepatocarcinogenesis in rats. NDEA treatment to rats resulted in significantly elevated levels of serum aspartate transaminase, alkaline phosphatase, lactate dehydrogenase and sorbitol dehydrogenase along with significant decrease in serum total protein and albumin/globulin ratio, which are indicative of hepatocellular damage. Hepatic malondialdehyde and nitric oxide levels were also elevated. Hepatic glutathione, protein thiol, glutathione reductase, glutathione peroxidase, glutathione-S-transferase, gammaglutamyl cysteine synthetase and gammaglutamyl transferase were significantly increased in NDEAtreated group as compared to the control rats indicating disturbances in oxidant/antioxidant status. A significant decrease in hepatic ATP level was recorded indicating failure of energy metabolism. Administration of DAS to the NDEA-treated rats resulted in restoration of most of enzymatic and non enzymatic liver function tests. Also, liver content of most of the measured oxidants and antioxidant systems, enzymatic as well as non enzymatic, were normalized. Moreover, administration of DAS to NDEAtreated rats showed significant increase in pyruvate, ATP contents and lactate dehydrogenase activity, along with decrease in lactate and lactate/pyruvate ratio as compared to NDEA-treated rats. The histopathological examination of the liver sections confirmed these results. In conclusion, DAS could attenuate NDEA-induced hepatocarcinogenesis by improving the oxidant/antioxidant balance as well as the energy status of the hepatic tissue. Key words: N-nitrosodiethylamine, hepatocarcinogenesis, diallyl sulfide, energy metabolism, oxidative stress, antioxidant systems. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/DA8B70C10187 http://dx.doi.org/10.5897/AJBR.9000041 en Copyright © 2008 Sherine M. Rizk and Safinaz S. Ibrahim

oai:academicjournals.org:AJBR:5F6025A10198 2008-10-31T00:00:00Z AcademicJournals AJBR AJBR:2008

Some properties of extracellular protease from Bacillus licheniformis LBBL-11 isolated from “iru”, a traditionally fermented African locust bean condiment Folasade M. Olajuyigbe and Joshua O. Ajele Full Length Research Paper Twelve strains of Bacillus licheniformis isolated from traditionally fermented African locust bean (iru) were evaluated in respect to production of protease on skim milk agar. B. licheniformis LBBL-11 exhibited the highest proteolytic activity with a diameter of clear zone measuring 35.0 mm. Production of protease from B. licheniformis LBBL-11 was further studied by growing the strain on nutrient broth. Maximum protease production was 18.4 U/ml at 48 hour of growth which coincided with the end of exponential phase. The protease from this Bacillus sphad optimum pH of 8.0 and was stable over a wide pH range of 5.0 - 11.0. The optimum temperature for the protease activity was 60oC. The enzyme was 95% stable at 60oC after 60 min of incubation. These properties indicate possible application of B. licheniformis LBBL-11 as potential starter culture for the fermentation of African locust bean under controlled conditions of temperature and pH. Key words: Fermented locust bean, iru, protease, thermostable, Bacillus licheniformis Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/5F6025A10198 http://dx.doi.org/10.5897/AJBR.9000218 en Copyright © 2008 Folasade M. Olajuyigbe and Joshua O. Ajele

oai:academicjournals.org:AJBR:A6738E610216 2008-11-30T00:00:00Z AcademicJournals AJBR AJBR:2008

Two-stage anaerobic digestion of aerobic pre-treated sisal leaf decortications residues: hydrolases activities and biogas production profile Anthony Manoni Mshandete, Lovisa Bjouml;rnsson, Amelia Kajumulo Kivaisi, Mugassa Steven Thomas Rubindamayugi and Bo Mattiasson Full Length Research Paper A two-stage system was investigated for anaerobic digestion (AD) of aerobically pre-treated sisal leaf decortication residue (SLDR) with regard to hydrolytic enzymes and biogas production. The system consisted of a solid-bed bioreactor for hydrolysis connected to methanogenic bioreactor packed with sisal fibre decortication residues (SFDR) as biofilm carriers. Some of the enzymes produced by microorganisms to hydrolyse SLDR were found to be pectinase, filter paper cellulase, amylase, beta;-glucosidase, carboxylmethyl cellulase, xylanase and protease. Enzyme activities observed in the acidogenic bioreactor were much higher than those in the methanogenic bioreactor. The hydrolysis and the methanogenic stages were well separated, as indicated by the high carbon dioxide production, high volatile fatty acids (VFAs) concentration and low pH in the acidogenic bioreactor compared with high methane production, low VFAs concentration and above neutral pH in the effluent of the methanogenic bioreactor. Digestion of SLDR gave energy yields of 2.45 kWh/kg volatile solids added in the form of methane. The integrity of the methane filter was maintained throughout the period of operation producing biogas with 51 - 70% methane content. A stable effluent pH showed that the methanogenic bioreactor had good ability to withstand the variations in load and VFAs concentrations that occurred in the two-stage process. In conclusion, the results of this study showed that the two-stage system was suitable for effective stabilization and biomethanation of SLDR. Key words. Anaerobic digestion, two-stage, sisal decortications residues, aerobic pre-treatment, biogas, hydrolases. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/A6738E610216 http://dx.doi.org/10.5897/AJBR.9000257 en Copyright © 2008 Anthony Manoni Mshandete, Lovisa Bjouml;rnsson, Amelia Kajumulo Kivaisi, Mugassa Steven Thomas Rubindamayugi and Bo Mattiasson

oai:academicjournals.org:AJBR:CCB88D410233 2008-11-30T00:00:00Z AcademicJournals AJBR AJBR:2008

Study of sensitivity and ability of adenosine deaminase in response to pre-unfolding and especially pathological temperatures via changing the enzyme structure and activity Mostafa Rezaei-Tavirani, Saeed Hesami-Takallu, Seyed Hassan Moghaddamnia, Shiva Kalantari, Bijan Ranjbar, Seyedeh Zahra Moosavi-Nejad, Sayed-Amir Marashi, Mohammad Rahmati Roodsari and Farhad Malekzad Full Length Research Paper Adenosine deaminase (ADA) is an important enzyme of the purine metabolic pathway, which catalyzes the conversion of adenosine and deoxyadenosine to their respective inosine derivatives plus ammonia, in a rapid and irreversible reaction. In this work, we studied the structural and kinetic properties of bovine ADA as a function of temperature in the range, 20 - 80deg;C by circular dichroism (CD) and UV- spectrophotometric techniques, as well as by measuring its activity in this temperature range. The results suggest that thermal unfolding of ADA occurs at temperatures above 60deg;C, while the enzyme undergoes detectable conformational changes during pre-unfolding heating. These changes affect the kinetics of reaction catalyzed by ADA. The relation between enzyme activity and structural changes is discussed. Key words. Adenosine deaminase (ADA), UV-Vis spectrophotometry, Conformational changes, Circular dichroism (CD), Kinetic study. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/CCB88D410233 http://dx.doi.org/10.5897/AJBR.9000225 en Copyright © 2008 Mostafa Rezaei-Tavirani, Saeed Hesami-Takallu, Seyed Hassan Moghaddamnia, Shiva Kalantari, Bijan Ranjbar, Seyedeh Zahra Moosavi-Nejad, Sayed-Amir Marashi, Mohammad Rahmati Roodsari and Farhad Malekzad

oai:academicjournals.org:AJBR:AAFAD2B10254 2008-12-31T00:00:00Z AcademicJournals AJBR AJBR:2008

Lipid peroxidation and tyrosinase inhibition by lichen symbionts grown in vitro Neeraj Verma, Bhaskar C. Behera, Anjali Sonone and Urmila Makhija Full Length Research Paper The symbionts of lichen species Arthothelium awasthii, Heterodermia podocarpa, and Parmotrema tinctorum were isolated and cultured on various nutrient media incubated in a growth chamber. Methanolic extracts of one year old symbiont cultures were taken for evaluating their potential to inhibit lipid peroxidation and tyrosinase enzyme activity. The extracts of all cultured lichen-symbionts have shown a concentration-time dependent inhibition of lipid peroxidation and tyrosinase activities. IC50 values for inhibition of lipid peroxidation by culture-extracts were 15.7 g for A. awasthii, 12.68 g for H.podocarpa and 11.47 g for P. tinctorum. Testing the impact of the extracts on tyrosinase activity, we found IC50 of 8.71 g (A. awasthii), 14.55 g (H.podocarpa) and 12.44 g (P. tinctorum). According to their IC50 the tested extracts turned out to be more effective for the tested parameters than the standard antioxidant Trolox (IC50 for lipid peroxidation 16.13 g) and Kojic acid tyrosinase inhibitor (IC50 for tyrosinase inhibition 17.63 g). The results suggest possible applications of lichen substances in the extracts of A. awasthii, H.podocarpa, and P. tinctorum symbionts as natural tyrosinase inhibitors. Key word: Lichen culture, tyrosinase inhibition. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/AAFAD2B10254 http://dx.doi.org/10.5897/AJBR.9000158 en Copyright © 2008 Neeraj Verma, Bhaskar C. Behera, Anjali Sonone and Urmila Makhija

oai:academicjournals.org:AJBR:AC5B10410277 2008-12-31T00:00:00Z AcademicJournals AJBR AJBR:2008

Maytenus ilicifolia as source of antioxidants and anti-radicals agents and its action on neutrophils peroxidase (myeloperoxidase) J. C. R. Vellosa, O. A. K. Khalil, N. M. Khalil, V. A. F. F. M. Santos, R. A. Hakime -Silva, M. Furlan, I. L. Brunetti and O. M. M. F. Oliveira Full Length Research Paper Maytenus ilicifolia is an important plant with a great potential for cancer treatment and has a popular and diffused use, as tea, in Brazil and in other countries against gastric ulcers, dyspepsia and others gastric problems. In this paper, the antioxidant and anti-radical activities of this plant were compared with trolox and uric acid by their abilities as scavengers of DPPHmiddot;, ABTSmiddot;+, O2middot;-, HOCl and NO. In all systems, a significant correlation existed between concentration of extracts and percentage inhibition of free radicals. Moreover, these extracts could inhibit oxidation of guaiacol catalyzed by peroxidases (horseradish peroxidase and myeloperoxidase) or by their prosthetic group, the hemin. The results provide useful pharmacological information against free radicals and reactive oxygen species, which are involved in a variety of pathological events like diabetes, cancer and aging. The crude extract and the hydroalcoholic fraction were able to act efficiently over all species assayed. This ability to scavenge radicals and endogenous reactive oxygen species, as well as to act as inhibitors of the enzymes that participate in their generation, would be useful for the treatment of various diseases mediated by radical species. Key words: Myeloperoxidase, celastraceae, oxidative damage, free radical,Maytenus ilicifolia. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/AC5B10410277 http://dx.doi.org/10.5897/AJBR.9000161 en Copyright © 2008 J. C. R. Vellosa, O. A. K. Khalil, N. M. Khalil, V. A. F. F. M. Santos, R. A. Hakime -Silva, M. Furlan, I. L. Brunetti and O. M. M. F. Oliveira

oai:academicjournals.org:AJBR:FDF293010284 2008-12-31T00:00:00Z AcademicJournals AJBR AJBR:2008

Effects of Landolphia owariensis leaf extract on the liver function profile and haemoglobin concentration of albino rats L. A. Nwogu, C. U. Igwe and A. A. Emejulu Short Communication The effects of aqueous extract of Landolphia owariensis leaves on the biochemical indices of liver function were investigated in Wister strain of albino rats. Preliminary phytochemical analysis of the plant leaves showed the presence of tannins, alkaloids, flavonoids and saponins. Acute toxicity tests of the extract gave an LD50of 3370 mg/kg. Liver function tests revealed that the serum activities of alanine aminotransferrase (ALT), aspartate aminotransferase (AST) and alkaline phosphatase (ALP), as well as the concentrations of total protein and albumin were not significantly (pgt;0.05) affected by the oral administration of the extract. However, bilirubin and haemoglobin concentrations decreased significantly (plt;0.05) on administration of the extract. The results suggest that L. owariensisleaf extract is not hepatotoxic in rats. The findings are of clinical importance given the various reported therapeutic potentials of the plant. Key words: Landolphia owariensis, hepatotoxicity, LD50, haemoglobin. Academic Journals 2008 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/FDF293010284 http://dx.doi.org/10.5897/AJBR.9000103 en Copyright © 2008 L. A. Nwogu, C. U. Igwe and A. A. Emejulu

oai:academicjournals.org:AJBR:F9A7D9B10319 2009-01-31T00:00:00Z AcademicJournals AJBR AJBR:2009

Regenerative action of Cochlospermum tinctorium aqueous root extract on experimentally induced hepatic damage in rats Etuk E. U., Francis U. U. and Garba I. Full Length Research Paper The hepatoprotective effect of aqueous root extract of Cochlospermum tinctoriumon carbon tetrachloride (CCl4) on induced hepatic damage in rats was reported. The present study examined the curative action of the plant extract on experimentally induced hepatic damage in rats. Wistar rats were divided into normal control, induction control, extract and prednisolone treated groups. Hepatotoxicity was induced in rats by intraperitoneal administration of CCl4 (30% in olive oil) for 5 days. Treatment group received 200 mg/kg of extract post hepatotoxicity induction orally for 7 days. The animals were sacrificed on the 8thday, blood and hepatic tissue collected for liver function test and histopathological analysis respectively. Administration of carbon tetrachloride induced hepatic damage in the rats was evidenced by a significant increase (P lt; 0.05) in the blood clotting time, serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (AP) and bilirubin as compared to the control. There was also a significant reduction in the serum total protein, serum albumin and reduced glutathione levels. Treatment with the extract reversed the values of all the biochemical parameters to near normal values in control. The histopathological reports collaborate with the biochemical analysis results. Oral administration of aqueous root extract of Cochlospermum tinctorium for 7 days has significantly reversed hepatic damage produced by CCl4 in wistar rats. Key words: Cochlospermum tinctorium, carbon tetrachloride, hepatotoxicity, wistar rats. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/F9A7D9B10319 http://dx.doi.org/10.5897/AJBR.9000205 en Copyright © 2009 Etuk E. U., Francis U. U. and Garba I.

oai:academicjournals.org:AJBR:A5997BB10334 2009-01-31T00:00:00Z AcademicJournals AJBR AJBR:2009

Efficacy of Dissotis rotundifolia on Trypanosoma brucei brucei infection in rats Abdullahi Mann, Evans C. Egwim, Barnabas Banji, Nda-Umar Abdukadir, Mohammed Gbate and J. T. Ekanem Full Length Research Paper The therapeutic potential of the crude extract of Dissotis rotundifolia was investigated in rats infected with Trypanosoma b. brucei. Animals were treated orally or intraperitoneally at 200, 600 and 800 mg/kg body weight. At 800 mg/kg, parasitemia was reduced by 66.7 and 78.4% after oral and intraperitoneal administration respectively. In vitro exposure of blood forms to high concentration (800 mg/kg) crude extract test resulted in complete paralysis or killing within 45 s of exposure. It is concluded that D. rotundifolia may contain antitrypanosomal constituents. Key words: Efficacy, trypanosoma, parasitemia, Dissotis rotundifolia, antitrypanosomal activity. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/A5997BB10334 http://dx.doi.org/10.5897/AJBR.9000113 en Copyright © 2009 Abdullahi Mann, Evans C. Egwim, Barnabas Banji, Nda-Umar Abdukadir, Mohammed Gbate and J. T. Ekanem

oai:academicjournals.org:AJBR:0F48A5810348 2009-02-28T00:00:00Z AcademicJournals AJBR AJBR:2009

Isolation and preliminary characterization of conophor nut (Tetracarpidium conophorum) lipase Victor N. Enujiugha Full Length Research Paper Lipase in oilseeds helps to hydrolyze the ester bonds of storage triacylglycerols. The crude lipase from the conophor nut (Tetracarpidium conophorum) was isolated and assayed via quantification of the free fatty acids liberated by the hydrolysis of the oilseed triacylglycerols. Optimum pH and temperature for the enzyme activity of the conophor nut lipase was pH 8.0 and at 30deg;C with substantial lipolysis at 80deg;C, underscoring the thermostability of the enzyme. The effects of different ions on the activity of the isolated lipase were examined. NaCl and EDTA inhibited activity by various degrees, while Ca2+ and Hg+ enhanced the enzyme activity. The results of the present study show that the lipase from conophor nut can favourably be exploited to complement existing lipase sources. Key words: Conophor nut, lipase activity, temperature, pH. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/0F48A5810348 http://dx.doi.org/10.5897/AJBR.9000150 en Copyright © 2009 Victor N. Enujiugha

oai:academicjournals.org:AJBR:1C8C55710356 2009-02-28T00:00:00Z AcademicJournals AJBR AJBR:2009

A study on the combined administration of chloroquine and insulin effect on serum transferases and phosphatases activity during increased dietary fat and calcium consumption Ajani E. O., Salau B. A., Ezima E. N. , Oyefuga O. H. and Osineye P. O. Full Length Research Paper Previous studies reported on relationship between chloroquine administration, insulin and glucose homeostasis, but the role of dietary fat and the combined effect of the drugs on liver function have not been exploited. The present study was set up to investigate the effect of combined administration of insulin and chloroquine on serum transferase and phosphates activity during increased dietary fat and calcium consumption. Thirty (30) adult male albino rats randomly assigned into five (5) groups were used in the study. Group A was placed on normal diet (normal control); B (test control) C, D, and E were placed on an increased dietary fat and calcium. Drugs were administered as follows: group C, insulin (100 g/kg body weight once daily); group D, chloroquine (Imarsel Chemical Co. Ltd., Chinon, Hungary, 15 mg/kg body weight) thrice weekly over a period of 12 weeks, and group E, chloroquine combined with insulin. All rats were sacrificed after 15 weeks treatment period. Blood was withdrawn and activities of the enzymes were determined. Combined administration of the drugs increased serum alanine amino transferase, aspartate transaminase and alkaline phosphate activity and decreased acid phosphatase activity. The result suggests that combined administration of insulin and chloroquine may result in hepatic injury particularly in individual whose dietary regimen includes increased fat and calcium. Key words: Chloroquine, insulin, liver function, transaminases, phosphatases, dietary calcium, fat. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/1C8C55710356 http://dx.doi.org/10.5897/AJBR.9000007 en Copyright © 2009 Ajani E. O., Salau B. A., Ezima E. N. , Oyefuga O. H. and Osineye P. O.

oai:academicjournals.org:AJBR:A5D5A3610364 2009-02-28T00:00:00Z AcademicJournals AJBR AJBR:2009

Antinociceptive properties of Trigonella foenumgreacum seeds extracts A. Laroubi, L. Farouk, R. Aboufatima, A. Benharref , A. Bagri and A. Chait Full Length Research Paper Trigonella foenum-graecum L. (Leguminosae), known in Morocco as ldquo;Helbardquo;, is used in folk medicine for its anti-ulcer, anti-inflammatory, cicatrizing activities and to treat various pain-related physiological conditions. In the present study, we attempted to verify the possible antinociceptive action of different extracts obtained from the seeds of this plant. Three experimental models were used (acetic acid, formalin, and hot-plate tests) in order to characterize the analgesic effect. The extracts significantly, and in a dose-dependent manner, reduced the pain induced by intraperitoneal injection of acetic acid. In the formalin test, the extracts, except ethyl acetate extract (Tfge), significantly reduced the painful stimulus but only in the early phase of the test. On the contrary, these extracts, except Tfge, were ineffective to increase the latency of licking or jumping in the hot plate test. These results suggest that the compounds present in the extracts activated both central and peripheral mechanisms to elicit the analgesic effect. Key words: Trigonella foenum-graecum seeds, writhing test, formalin test, hot-plate test, nociception, mice, rats. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/A5D5A3610364 http://dx.doi.org/10.5897/AJBR.9000031 en Copyright © 2009 A. Laroubi, L. Farouk, R. Aboufatima, A. Benharref , A. Bagri and A. Chait

oai:academicjournals.org:AJBR:C6EE06110375 2009-02-28T00:00:00Z AcademicJournals AJBR AJBR:2009

Toxicological assessment of oral administration of some antisickling agents in rats Oyewole, O. I. and Malomo, S. O. Full Length Research Paper This study investigated the toxicological effects of oral administration of hydroxyurea, tellurite and thiocyanate on some biochemical parameters in rats. The drugs were administered orally to rats daily at their therapeutic dose for 28 days after which some biochemical parameters were measured. All the drugs caused growth depression and significant elevation (P lt; 0.05) of serum alkaline phosphatase (ALP), alanine aminotransferase (ALT) and aspartate amino transferase (AST) while they also lowered serum albumin and total protein. Thiocyanate and tellurite significantly decreased activities of the three enzymes in the liver and kidney while hydroxyurea resulted in significant elevated activities. Tellurite significantly reduced serum concentrations of sodium ion and urea while it elevated serum potassium, creatinine and bilirubin. Hydroxyurea elevated serum urea and creatinine while it reduced bilirubin concentration. Thiocyanate significantly reduced (P lt; 0.05) serum bicarbonate and bilirubin. These results suggest that the drugs might be toxic at their therapeutic dose with thiocyanate exhibiting mildest toxicity followed by hydroxyurea. Key words: Sickle cell disease, hydroxyurea, sodium thiocyanate, potassium tellurite Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/C6EE06110375 http://dx.doi.org/10.5897/AJBR.9000251 en Copyright © 2009 Oyewole, O. I. and Malomo, S. O.

oai:academicjournals.org:AJBR:AD5BF9810390 2009-03-31T00:00:00Z AcademicJournals AJBR AJBR:2009

D-3-hydroxybutyrate oxidation in mitochondria by D-3-Hydroxybutyrate dehydrogenase in Tetrahymena pyriformis Omar Akil, Zakaria El Kebbaj, Norbert Latruffe and Mrsquo;Hammed Saiuml;d El Kebbaj Full Length Research Paper Tetrahymena pyriformis a ciliated protozoan, is considered a good indicator of water pollution. However its energy supply is poorly understood. This work was focused on the metabolism of hydroxybutyrate through the study of the membrane bound mitochondrial NAD+-dependent D-3-hydroxybutyrate dehydro-genase (EC. 1.1.1.30) (BDH), a ketone body catalysing enzyme involvedin the interconversion of D-3-hydroxybutyrate to acetoacetate. Due to lack of informations, the physico-chemical properties and kinetic parameters of the enzyme were examined. The results are the following: 1) D-3-hydroxybutyrate is a good substrate for mitochondria. 2) The enzyme catalytic process follows a bi bi-ordered mechanism where the coenzyme binds first, then allowing the substrate linkage to the active site. 3) Two optimal pH values of 8 and 6.5 corresponding to D-3-hydroxybutyrate oxidation and to acetoacetate reduction respectively. On the other hand, pH changes affect the coenzyme binding to the active site. 4) The BDH activity was found strongly linked to submitochondrial vesicles indicating that the protozoan enzyme is membranous and could require lipids for its function as well as it is for the mammalian enzyme. Moreover, an optimal temperature (40deg;C) and a break appearing in the Arrhenius plot at 19deg;C were found. The break suggests a membrane lipid fluidity-dependency of BDH conformational change. 5) Several ligands of the active site including methylmalonate and succinate modulate the BDH activity and are competitive inhibitors toward D-3-hydroxybutyrate. 6) Divalent cations, Mg2+, Mn2+ and Zn2+protect BDH against thermal inactivation. The protection is the strongest in the presence of Zn2+. Moreover, Ca2+ and Mg2+ are enzyme activators and modulate the substrate binding to the active site. On the other hand, EDTA, a chelating agent, inhibits the enzyme but prevents inhibition by substrate excess. This work provides new insights on the energy metabolism of T. pyriformis wild strain where D-3-hydroxybutyrate is a choice substrate where the properties of BDH have been established especially the activating role of non heavy divalent cations. Key words: D-3-hydroxybutyrate dehydrogenase, ketone body, mitochondria,Tetrahymena pyriformis. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/AD5BF9810390 http://dx.doi.org/10.5897/AJBR.9000069 en Copyright © 2009 Omar Akil, Zakaria El Kebbaj, Norbert Latruffe and Mrsquo;Hammed Saiuml;d El Kebbaj

oai:academicjournals.org:AJBR:719996510397 2009-03-31T00:00:00Z AcademicJournals AJBR AJBR:2009

Selected heavy metals and electrolyte levels in blood of workers and residents of industrial communities Babalola O. O and Babajide S. O Full Length Research Paper The study focused on the determination of the levels of lead, cadmium, sodium and potassium in the blood of selected industrial workers (n = 36), residents of the neighboring communities (n = 36) as well as the residents of the communities further away from any industrial setting (which controls) (n = 12). The subjects were recruited from the granite served as the, ceramic and cement industries at Ewekoro, Abeokuta North and South Local government areas of Ogun state,Nigeria. The blood lead (BPb) and cadmium (BCd) were determined by atomic absorption spectrophotometry, while blood sodium (BNa+) and potassium (BK+) were determined by flame photometry. The weight and height of all respondents were measured in addition to other information obtained through a structured questionnaire and their body mass indices computed. The mean BCd, BNa+ and BK+ for controls and the test subjects were not significantly different from each other. Significant difference was only observed in the level of BPb between the test and the control. This was also observed when comparing the mean of all the measurements in the blood of residents of the neighboring communities with that of the control subjects. These results revealed that workers and the residents of the neighboring communities are at the risk of lead poisoning to which they were exposed. Key words: Industrial communities, heavy metals level, electrolyte levels. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/719996510397 http://dx.doi.org/10.5897/AJBR.9000215 en Copyright © 2009 Babalola O. O and Babajide S. O

oai:academicjournals.org:AJBR:B20F75D10410 2009-03-31T00:00:00Z AcademicJournals AJBR AJBR:2009

Utilization of enzymes in the production of liquid sugar from dates Gamal A. El-Sharnouby , Salah M. Al-Eid and Mutlag M. Al ndash; Otaibi Full Length Research Paper Date palm fruits Phoenix dactylifera cultivated in the Kingdom of Saudi Arabia were used for the production of high quality date syrup. This syrup is suitable for the manufacture of different food products. Date syrup was prepared from Reziz date (Soft variety) at different ratios of water/date (2:1, 2.5:1 and 3:1). Pectinase and cellulase were used to obtain the maximum date syrup extraction. Data revealed that Reziz variety contained high total sugar content (about 83.51% on dry basis). The extraction rate of sugars increased as the water/flesh ratio increased. Also, the use of pectinase/cellulase gave the highest recovery of total soluble solids (65.6 to 70.7%) compared with control (50.5 to 56.30%). The resultant date syrups were evaluated for their physico-chemical characteristics and compared with cane syrup (Black honey). Results of the organoleptic evaluation proved that date syrup is considered to be highly desirable than cane syrup. Results indicate the possibility of employing pectinase/cellulase to produce concentrated date syrup from tamr fruits for use in food product development. Key words: Date fruits, Reziz, date syrup, pectinase, cellulose, physico-chemical characteristics. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/B20F75D10410 http://dx.doi.org/10.5897/AJBR.9000259 en Copyright © 2009 Gamal A. El-Sharnouby , Salah M. Al-Eid and Mutlag M. Al ndash; Otaibi

oai:academicjournals.org:AJBR:CD195C610418 2009-03-31T00:00:00Z AcademicJournals AJBR AJBR:2009

Toxicological effects of chlorpyrifos and methidathion in young chickens Ojezele, Matthew Obaineh and Abatan, Oluwole Matthew Full Length Research Paper The objective of this work is assessment of the toxicological effects of the organophosphorus compounds (methidathion and chlorpyrifos) and the usefulness of some parameters as bioindicators. Haematology and serum biochemistry were assayed in 15 cockrels at random age of 4 - 6 weeks. The birds were randomly assigned to 3 oral (by mouth) pulse-dose treatments of 0, 3.5 mg/kg chlorpyrifos, and 7.5 mg/kg methidathion, respectively. Haematology and serum biochemistry were used as indices of toxicosis. Significantly (P lt; 0.05) reduced WBC, Neutrophils and Lymphocyte counts were observed in the groups of birds dosed with chlorpyrifos and methidathion. PCV, Hb, and RBC were significantly decreased by methidathion while chlorpyrifos caused a significant increase in these parameters. Results obtained in this study also showed that methidathion and chlorpyrifos caused significant decrease in the levels of ALP, ALT, TP, and ALB. While methidathion caused a significant decrease in the level of AST reverse is the case for chlorpyrifos with respect to AST. It was also observed that both organophosphates had no significant effect on the level of BIL. The study thus showed that the evaluated parameters can serve as useful bioindicators of the sub lethal exposure to organophosphorus compounds. Key words: Biochemistry, chlorpyrifos, methidathion, bioindicators, cockrels, haematology. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/CD195C610418 http://dx.doi.org/10.5897/AJBR.9000252 en Copyright © 2009 Ojezele, Matthew Obaineh and Abatan, Oluwole Matthew

oai:academicjournals.org:AJBR:549D4B110430 2009-03-31T00:00:00Z AcademicJournals AJBR AJBR:2009

Degradation of pyrimidine ribonucleosides by extracts of Aspergillus terreus Osama M. Abdel-Fatah, Maysa A. Elsayed and Ali M. Elshafei Full Length Research Paper Cell-free extracts of nitrate-grown mycelia of Aspergillus terreus could catalyze the hydrolytic deamination of cytidine to uridine and ammonia followed by the hydrolytic cleavage of the N-glycosidic bond of the produced uridine to the corresponding base (uracil) and ribose. The same extracts could not catalyze the hydrolytic deamination of cytosine. Addition of inorganic arsenate to the reaction mixture containing cytidine or uridine did not affect the amount of ribose liberated indicating the absence of pyrimidine ribonucleosides phosphorylase in the extracts. Cytidine deaminase showed an optimum activity at pH 7.0 and 60deg;C and stability to high degrees of temperature. Uridine hydrolase activity was optimized at pH 8.0 and 55deg;C. Incubation of the extracts at 55deg;C for 60 min showed no effect on uridine hydrolase activity whereas incubation of the extracts at 60 and 70deg;C for different interval times caused a gradual decrease in activity and the enzyme lost its activity completely by incubation at 80deg;C for 15 min. Dialyzing the extracts showed no effect on cytidine deaminase activity and a decrease in uridine hydrolase activity. Addition of EDTA at a concentration of 5 x 10-3 M and 10-2 M caused an inhibition to the two enzymes activities. The presence of MgSO4 in the reaction mixture seems to activate greatly both enzymatic cytidine deamination (225 and 128% increases) and uridine hydrolysis (22 and 77% increases) at final concentrations of 5 x 10-3 M and 10-2 M respectively. However HgCl2 and CuSO4 were found to be potent inhibitors for both activities at the two concentrations. Keywords: Pyrimidine ribonucleosides, cytidine, uridine, cytidine deaminase, uridine hydrolase, Aspergillus terreus. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/549D4B110430 http://dx.doi.org/10.5897/AJBR.9000072 en Copyright © 2009 Osama M. Abdel-Fatah, Maysa A. Elsayed and Ali M. Elshafei

oai:academicjournals.org:AJBR:8A63F7210437 2009-03-31T00:00:00Z AcademicJournals AJBR AJBR:2009

Effect of 50 Hz electromagnetic fields on acid phosphatase activity K. S. Prashanth, T. R. S. Chouhan and Snehalatha Nadiger Full Length Research Paper The effect of extremely low frequency (ELF) electromagnetic field (EMF) (50 Hz 0.5 mT) on the activity of acid phosphatase (EC 3.1.3.2) was studied. In addition the factors affecting the enzyme activity such as the temperature, pH and substrate concentration were also investigated. The results show that ELF EMF have significant influence on enzyme activity. Upon EMF exposure Km increased from 0014 plusmn; 0.005 to 0.040 plusmn; 0.008 mM whereas Vmax increased from 0.991 plusmn; 0.254 to 1.638 plusmn; 0.345 mol/min. Further studies can probably help in finding suitable applications for ELF based modulation of enzyme activity. Key words: ELF EMF, acid phosphatase, enzyme activity. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/8A63F7210437 http://dx.doi.org/10.5897/AJBR.9000080 en Copyright © 2009 K. S. Prashanth, T. R. S. Chouhan and Snehalatha Nadiger

oai:academicjournals.org:AJBR:8FC0A2110458 2009-03-31T00:00:00Z AcademicJournals AJBR AJBR:2009

Lipid profile of a population of diabetic patients attending Nigerian National Petroleum Corporation Clinic, Abuja Ugwu, C. E. , Ezeanyika, L. U. S., Daikwo, M. A. and Amana, R. Full Length Research Paper This study was conducted to compare the lipid profile of diabetic patients and healthy controls. The lipid profiles and lipoprotein levels of 50 known diabetic patients and 50 healthy subjects were studied. Total cholesterol (TC), Triacylglycerols (TG), Low density lipoprotein-cholesterol (LDL-C), and high density lipoprotein cholesterol (HDL-C) levels were assayed for each group using standard biochemical methods. The mean TC, TG, and low density lipoprotein cholesterol levels were lower in the diabetics than in the control subjects though these were not significant (P gt; 0.05). The frequency of high TC level was higher in the diabetic group while the frequency of low HDL-C level was higher in the healthy controls. The prevalence of high TG and LDL-C were approximately equal in the two groups. The mean (plusmn;SD) HDL- C was significantly lower (P lt; 0.05) in males compared to the females for both diabetic and control groups. The better lipid profiles in the diabetic patients compared to the controls were apparently due to the regime of management of their condition. Key words: Diabetes, lipid profile, Nigerians. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/8FC0A2110458 http://dx.doi.org/10.5897/AJBR.9000159 en Copyright © 2009 Ugwu, C. E. , Ezeanyika, L. U. S., Daikwo, M. A. and Amana, R.

oai:academicjournals.org:AJBR:3A582B040785 2009-03-31T00:00:00Z AcademicJournals AJBR AJBR:2009

The effect of allelic variation on forage quality of brown midrib sorghum mutants with reduced caffeic acid O-methyl transferase activity R. K. Vogler, T. T. Tesso, K. D. Johnson and G. Ejeta Full Length Research Paper Sorghum brown midrib (bmr) mutants have reddish-brown vascular tissues in their leaves and stems as a result of changes in lignin content and subunit composition. Past research at Purdue University has generated a set of bmr sorghum mutants via chemical mutagenesis and established some to be allelic to each other. More recently, we identified additional spontaneous mutants in true breeding lines with marked phenotype and a range of agronomic characteristics. One such mutant, bmr-26, is of particular interest because it arose in a drought-tolerant sorghum line. Analysis of testcross hybrids between this spontaneous bmr mutant and the chemically induced mutants, bmr-6 and bmr-12, showed that the bmr-26 allele was allelic to bmr-12 and not to bmr-6. Both the bmr-12 and the bmr-26 mutations significantly reduced lignin content in leaf, blade, sheath, stem, and panicle tissue. The effect of the mutation was relatively more severe in bmr-12 than in bmr-26. The impact of the two mutations on cell wall composition in different tissues varied. The biggest effect of the bmr-12 mutation was in reduction of lignin in the sheath, whereas lignin content in panicles was more affected by the bmr-26 mutation. This suggested an allele-specific effect in tissue lignin reduction of these mutants. Cellulose and hemicellulose concentrations were also significantly higher in certain tissue types for both the induced and spontaneous mutants. Forage quality traits including percent NDF and ADF were significantly increased by both mutations. Improvement in in vitro dry matter digestibility as a result of the bmr-26 mutation was relatively small and was not proportional to the reduction in the lignin content. Key words: Acid detergent fiber (ADF), bmr, brown midrib, in vitro dry matter digestibility (IVDMD), lignin, neutral detergent fiber (NDF), Sorghum bicolor. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/3A582B040785 http://dx.doi.org/10.5897/AJBR.9000233 en Copyright © 2009 R. K. Vogler, T. T. Tesso, K. D. Johnson and G. Ejeta

oai:academicjournals.org:AJBR:35F19DB10496 2009-04-30T00:00:00Z AcademicJournals AJBR AJBR:2009

Fatty acid composition and properties of skin and digestive fat content oils from Rhynchophorus palmarum L. larva Edmond Ahipo Dueacute;, Herveacute; Ceacute;sar B. L. Zabri, Jean Parfait E.N. Kouadioand Lucien Patrice Kouameacute; Full Length Research Paper Skin and digestive fat content (DFC) oils from Rhynchophorus palmarum L. larva (Curculionidae) were extracted and their physicochemical properties were characterized. Water content (0.41 %) of skin oil was higher than the amount of DFC (0.04 %). While, the lipid fraction of the skin (35.16%) was slightly lower than the DFC (49.05%). The fatty acid compositions of the both oils were determined. Results showed that the most abundant fatty acids in skin and DFC oils were palmitic and oleic acids. In both oils, oleic fatty acid showed the highest percentage of composition of 45.62 and 46.71% for skin and DFC, respectively with palmitic acid followed close by 39.87 and 40.44%, respectively. In this study, saturated fatty acids accounted for 45.06 and 44.97% of total fatty acids, for skin and DFC oils, respectively. Myristic, myristoleic, stearic and linoleic acids were also detected in the both oils. Physicochemical properties of skin and DFC oils respectively include: iodine index, 51.22 and 48.35; acid value, 4.72 and 2.21; saponification value, 189.22 and 198.26; unsaponifiable matter, 0.97 and 0.98; peroxide index, 6.90 and 0; oleic acidity, 7.76 and 0.568; vitamin A, 0 and 12.04 and refractive index, 1.45440 and 1.45424. Results suggested that Skin and DFC oils from R. palmarum L. larva could deserve further consideration and investigation as a potential new multi-purpose product for nutritional, industrial, cosmetic and pharmaceutical uses. Key words: Fatty acids, digestive fat content, skin of larvae, oil, Rhynchophorus palmarum. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/35F19DB10496 http://dx.doi.org/10.5897/AJBR.9000122 en Copyright © 2009 Edmond Ahipo Dueacute;, Herveacute; Ceacute;sar B. L. Zabri, Jean Parfait E.N. Kouadioand Lucien Patrice Kouameacute;

oai:academicjournals.org:AJBR:CBB922010605 2009-04-30T00:00:00Z AcademicJournals AJBR AJBR:2009

Peripheral blood and C-reactive protein levels (CRP) in chronic periodontitis Balwant Rai, Jasdeep Kaur , Simmi Kharb, Rajnish Jain, S. C. Anand and Jaipaul Singh Full Length Research Paper Evidence for a potential link between periodontal disease and coronary heart disease (CHD) has accumulated in recent years. C-reactive protein is potential marker of cardiovascular risk and associated with periodontal disease. CRP levels were analyzed in 26 periodontitis patients and 23 healthy controls along with hemoglobin, red blood cell count (RBC), leukocyte cell count (total and differential WBC), platelet count. Total WBC, neutrophil and platelet counts and CRP levels were raised significantly in periodontitis patients as compared to controls (plt;0.01) while RBC count and hemoglobin were significantly lowered in periodontitis as compared to controls (plt;0.01). These findings suggest an important role of CRP in development of periodontitis. Routinely screening for CRP in periodontitis patients might be an important tool to prevent heart disease. Key words: C-reactive protein, WBC, RBC, thrombocyte, periodontitis, coronary heart disease. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/CBB922010605 http://dx.doi.org/10.5897/AJBR.9000183 en Copyright © 2009 Balwant Rai, Jasdeep Kaur , Simmi Kharb, Rajnish Jain, S. C. Anand and Jaipaul Singh

oai:academicjournals.org:AJBR:0BF73AB10599 2009-04-30T00:00:00Z AcademicJournals AJBR AJBR:2009

Kinetics studies of protease in fermenting locust beans (Parkia biglobosa) and melon seed (Citrullus vulgaris) C. Egwim Evans, J. Yisa and P. O. Egwim Full Length Research Paper Melon seed (Citrullus vulgaris) and locust bean (Parkia biglobosa) were separately subjected to a natural solid ndash; substrate fermentation for 5 days. The peak of protease (P.I) production from the fermenting melon seeds was 48 h while that of the protease (P.II) from fermenting locust bean was 96 h. Both P.I and P.II demonstrated maximum activity at 40deg;C. The peak of activity for P.I was observed between pH 6.6 to 7.6, whereas for P.II, the optimum pH was 5.8. The Michaelis ndash; Mentenrsquo;s constant (KM) as well as the maximum velocity (VMax) of activity were 4.8 x 10-2 M and 3.43 x 10-2/s, and 5.8 x 10-2 M and 5.1x10-2/s for both P.I and P.II respectively. The work concludes that fermenting melon and locust bean seeds may be a cheap and alternative source of proteases for industrial processes. Key words: Kinetics, protease, natural fermentation, locust bean, melon seed, alternative sources. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/0BF73AB10599 http://dx.doi.org/10.5897/AJBR.9000152 en Copyright © 2009 C. Egwim Evans, J. Yisa and P. O. Egwim

oai:academicjournals.org:AJBR:391788D10592 2009-04-30T00:00:00Z AcademicJournals AJBR AJBR:2009

Effect of Hibiscus sabdariffa anthocyanins on 2,4-dinitrophenylhydrazine-induced hematotoxicity in rabbits A. Ologundudu, A. O.Ologundudu, I. A. Ololade and F. O. Obi Full Length Research Paper In this study, the 2,4-dinitrophenylhydrazine-induced biochemical and hematological changes in rabbits were examined under the administrative protocol of anthocyanin extract from Hibiscus sabdariffa calyces. Blood levels of reduced glutathione (GSH) and malondialdehyde (MDA) as well as red blood cell counts (RBC), white blood cell counts (WBC), packed cell volume (PCV) and hemoglobin (Hb) concentration were determined as indices of alteration and protection. Relative to control, 2,4-dinitrophenylhydrazine (2, 4-DNPH) treatment significantly decreased (P lt; 0.05) blood level of GSH and significantly increased blood MDA level .It also significantly (P lt; 0.05) decreased RBC counts, PCV and Hb but increased WBC counts. On the other hand treatment of rabbits with Hibiscusanthocyanin extract led to significant (P lt; 0.05) increase in blood GSH, RBC counts, PCV and Hb and a decrease in MDA and WBC counts. These findings indicate that anthocyanin extract from dried calyces of H. sabdariffa protects the blood against 2, 4-DNPH lipoperoxidative and hemolytic effects. Key words: Rabbit, Hibiscus sabdariffa, anthocyanin extract, 2,4 dinitrophenylhydrazine, reduced glutathione, malondialdehyde, complete blood count. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/391788D10592 http://dx.doi.org/10.5897/AJBR.9000092 en Copyright © 2009 A. Ologundudu, A. O.Ologundudu, I. A. Ololade and F. O. Obi

oai:academicjournals.org:AJBR:65C53BD10587 2009-04-30T00:00:00Z AcademicJournals AJBR AJBR:2009

Effects of ethanolic and aqueous leaf extracts of Landolphia owariensis on the serum lipid profile of rats Nwangwu Spencer C., Ike Francisca, Olley Misan, Oke James M., Uhunmwangho Esosa, Amegor, O. F. Ubaoji Kingsley and Nwangwu Udoka Full Length Research Paper The lipid profile of normal adult male rats administered both ethanolic and aqueous leaf extracts of Landolphia owariensis (P. Beauv) were determined. The animals were distributed into two sets of four groups with five animals in each group. Each set had one group, which served as control while the other three groups in the two sets were administered different concentrations of the ethanolic and aqueous leaf extracts. The control groups were administered normal saline and the other groupsrsquo; 100, 200 and 300 mgkg-1 of the ethanolic and aqueous extracts respectively, twice daily for two weeks. The Total cholesterol (TC), Triacylglyceride (TAG), High Density Lipoprotein-Cholesterol (HDL-C), Low Density Lipoprotein- Cholesterol (LDL-C), and Very Low Density Lipoprotein (VLDL) levels were determined in both sets by colorimetric methods. The ethanolic extract showed a marked reduction of 87.45% in LDL-C level with the 100 mgkg-1 dose, though effect of all the three concentrations were significant but depreciated with increase in concentration. Animals administered both the extracts at all three concentrations increased in their HDL-C levels, but effect was pronounced in 100 and 200 mgkg-1with 15 and 150% increases respectively, in the aqueous extract group. There were dose-dependent reductions of TC levels, with the 100, 200 and 300 mgkg-1with reduction of 40.78, 37.59 and 34.56% respectively, in ethanolic extracts. There were 50.55 and 55.33% reduction in 100 and 200 mgkg-1 of the aqueous extracts on TAG level. The results are indicative of the hypocholesterolaemic potentials ofL. owariensis leaf extracts. Key words: Aqueous extract, ethanolic extract, Hypocholesterolaemia, Landolphia owariensis. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/65C53BD10587 http://dx.doi.org/10.5897/AJBR.9000100 en Copyright © 2009 Nwangwu Spencer C., Ike Francisca, Olley Misan, Oke James M., Uhunmwangho Esosa, Amegor, O. F. Ubaoji Kingsley and Nwangwu Udoka

oai:academicjournals.org:AJBR:CA6F24310571 2009-04-30T00:00:00Z AcademicJournals AJBR AJBR:2009

Efficacy of defatted soy flour supplement in Gulabjamun Awadhesh Kumar Singh, Dattatreya Mahadev Kadam, Mili Saxena and R. P. Singh Full Length Research Paper Study was undertaken to determine the efficacy of defatted soy flour mix levels inGulabjamun (sweet dessert comprised of fried milk balls dipped in sugar syrup)and its impact on the quality parameters. Soy flour was fortified in three levels (3.33, 6.66 and 9.99%) w/w to prepare different compositions of Gulabjamuns by replacing wheat-flour in control recipe. 10 g spherical shape balls were made using thoroughly mixed ingredients dough and these were deep-fried in oil before soaking in sugar syrup (50deg;Brix for 4 h) at 70deg;C. Standard methods were used to estimate protein and crude fat content in Gulabjamun. Significant effect of raw premixes, prior to sugar syrup dipping, was observed due to addition of defatted soy flour on protein and fat content. Protein content was decreased to 18.24% from 20.66% and fat content increased to 28.36 from 12.09% in deep-fried samples from raw premix. Hardness, cohesiveness, springiness/elasticity, gumminess and chewiness values were increased with the increase in the soy flour levels. Appearance, colour, texture, flavour and overall acceptability of the Gulabjamunshad improved with the addition of 3.33% soy flour and decreased there after. Key words: Fat, fortification, Gulabjamun, protein, sensory attributes, soy flour, TPA. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/CA6F24310571 http://dx.doi.org/10.5897/AJBR.9000112 en Copyright © 2009 Awadhesh Kumar Singh, Dattatreya Mahadev Kadam, Mili Saxena and R. P. Singh

oai:academicjournals.org:AJBR:6AC98DC10564 2009-04-30T00:00:00Z AcademicJournals AJBR AJBR:2009

Purification of human serum paraoxonase: A simple and rapid method A.J. Mahadesh Prasad, K. Kemparaju, Elizabeth A Frank and Cletus J.M. Drsquo;Souza. Full Length Research Paper Paraoxonase/arylesterases (EC.3.1.8.2) is an enzyme found tightly associated with high density lipoprotein particle in serum. Because of its unique enzyme activity, antioxidant property and its role as an anti atherosclerotic molecule, various methods are used for its purification from human serum. Methods involved in its purification are elaborate and complicated. Also the yield and final activity are highly variable. Here, we report a 2 step method of purification involving affinity chromatography on cibacron blue sepharose followed by gel filtration on sephadex G50.The final preparation was 27.7 fold purified compared with the serum and gave a single band in SDS-PAGE by silver staining. Key words: Cibacron blue sepharose, paraoxonase, phenyl acetate, SDS-PAGE, silver staining. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/6AC98DC10564 http://dx.doi.org/10.5897/AJBR.9000200 en Copyright © 2009 A.J. Mahadesh Prasad, K. Kemparaju, Elizabeth A Frank and Cletus J.M. Drsquo;Souza.

oai:academicjournals.org:AJBR:FB5F3AB10555 2009-04-30T00:00:00Z AcademicJournals AJBR AJBR:2009

Effect of administration of acetylsalicylic acid on phosphatase enzymes in liver of metabisulphite treated rats J. E. Olajide, M. A. Akanji, J. Omale and N. O. Mohammad Full Length Research Paper Membrane stabilization is an established attribute of most anti-inflammatory drugs. In this work the membrane stabilization capability of acetylsalicylic acid (ASA) was investigated in the liver of metabisulphite insulted experimental rats. Previous reports have shown that sodium metabisulphite administered to rats resulted in labilization of plasma membrane of some rat tissues while acetylsalicylic acid, an anti-inflammatory drug, like certain others, has been reported as membrane stabilizer. The organ of interest (liver) was collected into a 0.25 M sucrose and the homogenate was prepared for enzyme analyses. The activities of the phosphatases were measured using standard methods. Initial administration of metabisulphite alone showed an immediate significant decrease with (Plt;0.05) in alkaline phosphatase activities. Loss in activities was recorded throughout the experimental period but became insignificant after day 3. The activities of the phosphatases in acetylsalicylic acid treated rats were lower when compared with the control group but not as obvious as with the metabisulphite treated rats. The combination treatment (metabisulphite and acetyl salicyclic acid) gave a trend in activities that was in between the administration of individual compounds. This study therefore has shown that acetylsalicyclic acid prevented disruption of liver cellular membrane caused by the administration of sodium metabisulphite. Key words: Acetylsalicylic acid, metabisulphite, liver, phosphatases, administration. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/FB5F3AB10555 http://dx.doi.org/10.5897/AJBR.9000081 en Copyright © 2009 J. E. Olajide, M. A. Akanji, J. Omale and N. O. Mohammad

oai:academicjournals.org:AJBR:2CA822810541 2009-04-30T00:00:00Z AcademicJournals AJBR AJBR:2009

Effect of experimental Schistosomiasis mansoni infection on serum levels of iron, zinc and copper in the olive baboon (Papio anubis) Mungatana N. W. K., Ngure R. M., Shitandi A. A., Mungatana C. K. and Yole D. S. Full Length Research Paper Schistosoma mansoniasis is a disease of grave concern due to its high morbidity and mortality in parts of the world. This study aimed at providing insight into the pathogenesis of S. mansoniasis as an aid in the development of effective control methods. Iron, zinc and copper concentrations were spectrophotometrically measured in sequential serum specimens obtained from baboons throughout the course of acute S. mansoni infection, following curative treatment with praziquantel and following post-treatment challenge with a second cercarial infection. The initial infection resulted in a two-fold increase in copper concentrations by Day 102 post-infection. Iron concentrations fell to almost half of pre-infection concentrations by Day 123 post-infection, while those of zinc fell to a third of pre-infection concentrations by Day 81 post-infection. These changes were seen to recover several weeks following treatment, though pre-infection concentrations were never achieved. Haptoglobin, a sensitive biomarker in the acute phase response of S. mansoni, was also measured at all sampling points. Haptoglobin changes were in concordance with those of the cations. The findings demonstrate that iron, zinc and copper are reactants in the acute phase response of S. mansoni in the nonhuman primate model, Papio anubis. Furthermore, these reactants are modulated in challenge infections and may be important in the immunopathology of the disease. Key words: Acute phase response, Schistosomiasis mansoni, serum iron, serum zinc, serum copper. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/2CA822810541 http://dx.doi.org/10.5897/AJBR.9000088 en Copyright © 2009 Mungatana N. W. K., Ngure R. M., Shitandi A. A., Mungatana C. K. and Yole D. S.

oai:academicjournals.org:AJBR:1CC9C4210548 2009-04-30T00:00:00Z AcademicJournals AJBR AJBR:2009

Epidemiological and biochemical studies of human lymphatic filariasis and associated parasitoses in Oguta, South-Eastern, Nigeria Okey A. Ojiako and G. O. C. Onyeze Full Length Research Paper Possible organ infections associated with human filariasis, helminthiasis and malaria in Oguta Local Government Area of Imo State, South-Eastern Nigeria were investigated. Blood, urine and stool samples were collected in appropriate containers from 200 male and female respondents aged 31 ndash; 85 years. Parasitological studies were carried out on blood samples for malaria and/or microfilariae parasites while stool samples were tested for the presence of some intestinal parasites. The study showed a prevalence of intestinal protozoa (Entamoeba histolytica), Wuchereria bancrofti, the intestinal helminthes Ascaris lumbricoides and Hookworms. Biochemical parameters of liver integrity were also studied across the various infection cohorts among the respondents. Results obtained show that these parasitic infections depressed the hematological parameters relative to lsquo;normalrsquo; respondents. Comparative biochemical analyses showed significant (p lt; 0.05) differences in some liver function parameters obtained for infected respondents relative to those not infected. There was also a positive correlation between age brackets with highest filarial infection (with no malarial co infection) and age groups with elevated markers of liver dysfunction. This study can be of immense diagnostic value in the clinical management of the filariases especially in malaria-endemic and resource-poor areas. Key words: Filariasis, co-parasitoses, Nigeria, prevalence patterns, liver dysfunction. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/1CC9C4210548 http://dx.doi.org/10.5897/AJBR.9000116 en Copyright © 2009 Okey A. Ojiako and G. O. C. Onyeze

oai:academicjournals.org:AJBR:18AA17B10479 2009-04-30T00:00:00Z AcademicJournals AJBR AJBR:2009

Enhancing antioxidant availability in grains of wheat plants grown under seawater-stress in response to microalgae extracts treatments Hanaa H. Abd El-Baky Full Length Research Paper This study investigated the antioxidant capacity and the levels of enhanced total carotenoids (TCAR), tocopherols (TOC) and phenolic (TPC) and protein (PC) contents in whole grains of wheat plants irrigated 10 and 20% (v/v) seawater (SW) in response to water extracts of microalgae Spirulina maxima (SME) and Chlorella ellipsoida (CEE) and exogenous plant growth enhancers of ascorbic acid (Vit. C) and benzyladinin (BA) treatments. Significant differences (P lt; 0.05) in amounts of TCAR (ranged 80 to 140 g/g), TOC (ranged 50.4 to 115 g/g), TPC (ranged 0.80 to 2.96 mg/g) and PC (ranged 9.34 to 13.79 %) in wheat grains among all treated plants were observed. The levels of their compounds increase related to irrigation-SW combined with algal treatments. The ethanolic extracts of grains of SW-stress plants treated with algal extracts exhibited high antioxidant capacity based on scavenging of DPPH and ABTS radicals than other samples. This activity remarked correlation with levels of antioxidant compounds present in these extracts. The electrophoretic profiles (SDS-PAGE fingerprint) of grains protein of treated samples exhibited similar pattern that in controls samples. It is concluded that the application of algal extracts to wheat plants irrigated SW lead to increase antioxidative components and protein content; hence consumption of these whole grains may render beneficial health effects. Key words: Microalgae, antioxidant activity, phenolics, proteins, seawater. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/18AA17B10479 http://dx.doi.org/10.5897/AJBR.9000115 en Copyright © 2009 Hanaa H. Abd El-Baky

oai:academicjournals.org:AJBR:FE2593B10487 2009-04-30T00:00:00Z AcademicJournals AJBR AJBR:2009

Effect of traditionally designed nutraceutical on stress induced immunoglobulin changes at Antarctica P. Bansal, R. Sannd, N. Srikanth and G. S. Lavekar Full Length Research Paper This study was conducted to establish the effect of a traditionally designed nutraceutical on stress related changes in selected immunoglobulin levels in the body. The nutraceutical was prepared from different potent herbs described in Ayurveda using standard operative procedures and were tested for heavy metal and microbial load. Initially, 21 subjects were selected in addition to 7 volunteers for control group who did not consume nutraceutical. Sampling was done at zero days and at fortnightly intervals. The levels of selected immunoglobulin IgG, IgA and IgM were estimated with turbidity metric immunoassay at different time intervals. The concentration of immunoglobulin IgA was 146plusmn;15.96 at zero day stage. The levels of these immunoglobulins were lower at all stages as compared to the concentration at zero day in trial group subjects whereas the concentration was significantly higher (t stat.gt;t critic. at plt; 0.05) in control group subjects. The concentration of IgG was very high to the tune of 3091plusmn;705 at zero day stage. The level of IgG was lower in trial subjects as compared to control subjects at all stages except at the 6th week stage where it was higher in trial subjects. Concentration of immunoglobulin IgM was 80.75plusmn;30.39 (t stat.gt;t critic. at plt; 0.05) at zero day followed by a decrease in both groups at the 2nd week, however the concentration was almost 1/3rd in trial drug subjects as compared to the levels in control subjects followed by an abrupt increase at the 4th week. The levels increased to 106plusmn;8.94 at the 4th week stage and 115plusmn;9.35 at the 6th week stage in control subjects (even higher than at zero day) whereas the values were 46.15plusmn;11.39 and 55.38plusmn;15.34 (t stat.gt;t critic. at plt; 0.05) at respective stages in trial drug subjects. On the whole the pattern of fall and rise in levels of IgM were similar in the control as well as treatment group subjects at all stages. Studies revealed that the components of the nutraceutical tended to exert significant (t stat.gt;t critic. at plt; 0.05) anti-stress effect against stress related changes in immunoglobulin in the body due to the battery of stresses encountered atAntarctica. Key words: Rasayana, immunoglobulins, Withania somnifera, Tinospora cordifolia, Chlorophytum arundinaceum, Piper longum, Prunus amygdalus, Antarctica, stress. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/FE2593B10487 http://dx.doi.org/10.5897/AJBR.9000095 en Copyright © 2009 P. Bansal, R. Sannd, N. Srikanth and G. S. Lavekar

oai:academicjournals.org:AJBR:0CB9F5C10522 2009-04-30T00:00:00Z AcademicJournals AJBR AJBR:2009

Regenerative action of Cochlospermum tinctorium aqueous root extract on experimentally induced hepatic damage in rats Etuk E. U., Francis U. U. and Garba I. Full Length Research Paper The hepatoprotective effect of aqueous root extract of Cochlospermum tinctoriumon carbon tetrachloride (CCl4) ndash; induced hepatic damage in rats was reported. The present study examined the curative action of the plant extract on experimentally induced hepatic damage in rats. Wistar rats were divided into normal control, induction control, extract and prednisolone treated groups. Hepatotoxicity was induced in rats by intraperitoneal administration of CCl4 (30% in olive oil) for 5 days. Treatment group received 200 mg/kg of extract post hepatotoxicity induction orally for seven days. The animals were sacrificed on the 8th day, blood and hepatic tissue collected for liver function test and histopathological analysis respectively. Administration of carbon tetrachloride induced hepatic damage in the rats that was evidenced by a significant increase (P lt; 0.05) in the blood clotting time, serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (AP) and bilirubin as compared to the control. There was also a significant reduction in the serum total protein, serum albumin and reduced glutathione levels. Treatment with the extract reversed the values of all the biochemical parameters to near normal values in control. The histopathological reports collaborate with the biochemical analysis results. Oral administration of aqueous root extract of C. tinctorium for seven days has significantly reversed hepatic damage produced by CCl4 in wistar rats. Key words: Cochlospermum tinctorium, carbon tetrachloride, hepatotoxicity, wistar rats. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/0CB9F5C10522 http://dx.doi.org/10.5897/AJBR.9000206 en Copyright © 2009 Etuk E. U., Francis U. U. and Garba I.

oai:academicjournals.org:AJBR:499890910533 2009-04-30T00:00:00Z AcademicJournals AJBR AJBR:2009

Antisickling property of Carica papaya leaf extract N. O. A. Imaga, G. O. Gbenle, V. I. Okochi, S. O. Akanbi, S. O. Edeoghon, V. Oigbochie, M. O. Kehinde and S. B. Bamiro Full Length Research Paper Sickle cell disease (SCD) results from a mutation in the hemoglobin inside the red blood cells, where a glutamic acid at position 6 is replaced by a valine. Many phytomedicines have been identified as potential antisickling agents, stemming from reported usage as ethnomedicines by the local folk. This research examined methanolic leaf extracts of Carica papaya L. (Caricaceae) for possible in vitroantisickling and membrane-stabilizing activities involving the use of positive (p-hydroxybenzoic acid 5 mg/ml) and negative (normal saline) controls for the antisickling experiments and osmotic fragility test on Hbss red blood cells obtained from non-crisis state sickle cell patients. Fragiliograms indicated that the plant extract reduced hemolysis and protected erythrocyte membrane integrity under osmotic stress conditions. Pretreatment of SS cell suspensions with C. papayaleaf extract inhibited formation of sickle cells under severe hypoxia, with only 0 - 5% sickle cells at 40 min compared with untreated SS cell suspensions which had over 60% sickle cells. These results indicate the feasibility of C. papaya as an attractive potential candidate for SCD therapy. Key words: Antisickling, membrane-stabilizing, sickle cell disease, erythrocyte fragility, Carica papaya, toxicity profile. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/499890910533 http://dx.doi.org/10.5897/AJBR.9000034 en Copyright © 2009 N. O. A. Imaga, G. O. Gbenle, V. I. Okochi, S. O. Akanbi, S. O. Edeoghon, V. Oigbochie, M. O. Kehinde and S. B. Bamiro

oai:academicjournals.org:AJBR:A4B63F910504 2009-04-30T00:00:00Z AcademicJournals AJBR AJBR:2009

Cholesterol concentration in different parts of bovine meat sold in Nsukka, Nigeria: Implications for cardiovascular disease risk Chukwunonso E. C. C. Ejike and Tufon N. Emmanuel Short Communication Cardiovascular disease (CVD) is a leading cause of mortality globally. Reducing dietary fat and cholesterol intake is central to the reduction in the risk of CVD. In Nigeria and other developing countries, meat is a good source of protein and other nutrients, and its consumption is increasing. This study investigates the cholesterol concentration of ten parts of bovine meat ndash; rib muscle, fore-limb muscle, hind-limb muscle, lungs, large intestine, small intestine, colon, liver, kidney and heart. Standard biochemical methods were used for all assays. The results show that cholesterol concentration was highest in the liver (6.5 plusmn; 0.15 mg/g) and lowest in the large intestine (1.0 plusmn; 0.01 mg/g). Organ meats had more cholesterol per 85 g serving than the daily recommendations of the American Heart Association. Considering that meat has some beneficial effects, we conclude that while bovine meat should not be avoided completely, its consumption (especially bovine organ meats consumption) should be minimized particularly by individuals and populations at risk of CVD and its co-morbid conditions. Key words: Bovine meat, cardiovascular disease, cholesterol concentration. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/A4B63F910504 http://dx.doi.org/10.5897/AJBR.9000060 en Copyright © 2009 Chukwunonso E. C. C. Ejike and Tufon N. Emmanuel

oai:academicjournals.org:AJBR:D2CA89F11067 2009-05-31T00:00:00Z AcademicJournals AJBR AJBR:2009

Modulation of di- (2- ethylhexyl) phthalate induced hepatic toxicity by Apium graveolens L. seeds extract in rats G. C. Jain, Hemant Pareek, B. S. Khajja, Kusum Jain, S. Jhalani, S. Agarwal and Sameer Sharma Full Length Research Paper In the present study, the hepatoprotective activity of methanolic extract of Apiumgraveolens L. (celery) seeds was tested against Di-(2- ethylhexyl) phthalate(DEHP) induced hepatotoxicity in rats. Oral administration of DEHP (1000 mg/kg b.wt/day) for 6 weeks in rats caused a significant increase in the levels of serum marker enzymes like serum glutamate oxaloacetate transaminase (SGOT), serum glutamate pyruvate transaminase (SGPT), alkaline phosphatases (ALP) and the levels of total bilirubin and hepatic lipid peroxidation (TBARS). The levels of serum protein, hepatic glutathione (GSH) and ascorbic acid were decreased, administration of A.graveolens seeds extract (300 mg/kg b.wt./day p.o.) for 6 weeks results in a significant recovery of these biochemical parameters toward normalcy compared with the DEPC treated and control rats. Key words: Apium graveolens, hepatic toxicity, di-(2- ethylhexyl) phthalate, hepatic marker enzymes Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/D2CA89F11067 http://dx.doi.org/10.5897/AJBR.9000165 en Copyright © 2009 G. C. Jain, Hemant Pareek, B. S. Khajja, Kusum Jain, S. Jhalani, S. Agarwal and Sameer Sharma

oai:academicjournals.org:AJBR:27FC7A111058 2009-05-31T00:00:00Z AcademicJournals AJBR AJBR:2009

Hepatoprotective potential of crocin and curcumin against iron overload-induced biochemical alterations in rat Shoddy A. EL-Maraghy, Sherine M. Rizk and Maha M. El-Sawalhi Full Length Research Paper The present study was undertaken to evaluate the possible ameliorating effect of crocin and curcumin on certain biochemical alterations associated with iron overload-induced liver injury in rats. 5 groups of rats were used, a normal control group received daily i.p. injections of saline and 4 groups received daily i.p. injections of ferric nitrilotriacetate (FeNTA) for 8 successive days, the dose of iron was increased during the experimental period (from 6 to 15 mg Fe/kg). The first iron overloaded group kept without further treatment and served as a positive control group. The second iron overloaded group received daily i.p injections of crocin (200 mg/kg ) in saline. The 3rd and the 4th iron overloaded groups received orally either 0.5% carboxy methyl cellulose (CMC) or curcumin (100 mg/kg) in CMC respectively. Treatment started 3 days before and concurrently with iron administration for 8 days. Results revealed that iron-induced liver injury was reflected by significant changes in the liver function indices, hyperammonemia and reduced serum urea level. A significant deposition of iron in liver was associated with enhanced oxidative and nitrosative stress status. Moreover, iron overloaded rats exhibited significant alterations in liver energy metabolism together withdiminished ureogenesis and a decline in dimethylarginine dimethylaminohydrolaseactivity. Supplementation with either crocin or curcumin ameliorated most of the biochemical changes induced by iron overload in rat liver. A function that may be beneficial for populations at risk for iron overload. Key words: Iron overload, liver, rat, oxidative stress, energy metabolism, ureogenesis, crocin, curcumin. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/27FC7A111058 http://dx.doi.org/10.5897/AJBR.9000131 en Copyright © 2009 Shoddy A. EL-Maraghy, Sherine M. Rizk and Maha M. El-Sawalhi

oai:academicjournals.org:AJBR:0250B9B11051 2009-05-31T00:00:00Z AcademicJournals AJBR AJBR:2009

Glutathione S-transferase activity of erythrocyte genotypes HbAA, HbAS and HbSS in male volunteers administered with fansidar and quinine P. C. Chikezie, A. A. Uwakwe and C. C. Monago Full Length Research Paper In vivo investigations were carried out to ascertain the comparative levels of erythrocyte GST activity between non-malarious and malarious male subjects of HbAA, HbAS and HbSS erythrocyte genotypes, administered with fansidar and quinine. The incubation of human erythrocytes with 1-chloro-2,4-dinitrobenzene (CDNB) resulted in almost quantitative conjugation of glutathione (GSH) to form S-(2,4-dinitrophenyl) glutathione. Determination of GST activity was carried out at 0, 3, 6 and 18 h, after two antimalarial drugs (Fansidar and quinine) were adminis-tered to the volunteers. The control values of non-malarious and malarious individuals ranged between (3.27 to 12.50 iu/gHb) and (2.75 to 12.21 -iu/gHb) respectively. Erythrocyte GST activity was significantly (p lt; 0.05) lower in P. falciparum infected red cells compared to normal ones, except parasitized male HbSS erythrocytes. Generally, the pattern of in vivo erythrocyte GST activity in the presence of the 2 antimalarial drugs showed 2 phase profile. The first stage showed decreasing levels of relative GST activity within approximate time range of 6 h after the drugs were administered to the volunteers. The second phase showed recovery of erythrocyte GST activity (6 - 18 h approx.) from the inhibitory effects of the drugs. Key words: Glutathione S-transferase (GST) activity, erythrocytes, fansidar, quinine, 1-chloro-2, 4-dinitrobenzene (CDNB). Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/0250B9B11051 http://dx.doi.org/10.5897/AJBR.9000127 en Copyright © 2009 P. C. Chikezie, A. A. Uwakwe and C. C. Monago

oai:academicjournals.org:AJBR:9356B5D11040 2009-05-31T00:00:00Z AcademicJournals AJBR AJBR:2009

Lipid composition of microsomal fraction of female rat liver at different stages of growth Chidozie, V. N., Anekwe, G. E., Chukwu, O. O. C., Olabode, O. A., Igweh, A. C. and Adeyanju, O. N. Full Length Research Paper It has been reported that lipids are the only macromolecules which display consistency in their pattern of biosynthesis for all living system. In this study, lipid biosynthesis in the liver microsomes of female Sprague-Dawley rats as they aged (3, 7, 12 , 16 and 20 weeks) was studied. The microsomes were isolated by homogenization and centrifugation. The aliquot of the microsomes and soluble enzymes fraction were dried and separated into neutral and polar lipids. The separation of neutral and polar lipids fractions was by silicic acid column chromatography. The data obtained from the study showed that the total lipid content of the rat liver microsomes, the cholesterol, the triglycerides, and the polar (phosphoglycerides) lipids increased as the rats grew older. The results imply that similar pattern of lipid biosynthesis occurs in rats as in humans. This study has given a better understanding of the pattern of biosynthesis of lipids in female rats. Key words: Liver microsomes, cholesterol, triglycerides, phosphoglycerides, lipidoses. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/9356B5D11040 http://dx.doi.org/10.5897/AJBR.9000157 en Copyright © 2009 Chidozie, V. N., Anekwe, G. E., Chukwu, O. O. C., Olabode, O. A., Igweh, A. C. and Adeyanju, O. N.

oai:academicjournals.org:AJBR:8557BC011034 2009-05-31T00:00:00Z AcademicJournals AJBR AJBR:2009

Effect of 3-hydroxymethyl xylitol on hepatic and renal functional markers and protein levels in streptozotocin-diabetic rats Govindasamy Chandramohan, Khalid S. Al-Numair and Kodukkur Viswanathan Pugalendi Full Length Research Paper Oral administration of 3-hydroxymethyl xylitol at 40 mg/kg body weight to diabetic rats for 45 days resulted in a significant reduction in blood glucose and significant increase in plasma insulin levels. In addition, the diabetic rats had decreased levels of plasma total protein, albumin, globulin and albumin/globulin ratio as compared to control rats. After treatment with 3-hydroxymethyl xylitol and glibenclamide total protein, albumin, globulin and albumin/globulin ratio were brought back to near normal. The activities of hepatic and renal markers were significantly elevated in diabetic rats as compared to control rats. Treatment with 3-hydroxymethyl xylitol and glibenclamide reversed these parameters to near normal levels. In diabetic rats, the decreased levels of urea, uric acid and creatinine with increased levels of albumin and urine volume was observed, and treatment with 3-hydroxymethyl xylitol and glibenclamide reversed these parameters to near normal. These results indicate that 3-hydroxymethyl xylitol, a compound isolated from Casearia esculenta, has beneficial effect on hepatic and renal functional markers. Key words: Casearia esculenta, 3-hydroxymethyl xylitol, glibenclamide, diabetes, liver, kidney, functional markers. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/8557BC011034 http://dx.doi.org/10.5897/AJBR.9000079 en Copyright © 2009 Govindasamy Chandramohan, Khalid S. Al-Numair and Kodukkur Viswanathan Pugalendi

oai:academicjournals.org:AJBR:E62326811023 2009-05-31T00:00:00Z AcademicJournals AJBR AJBR:2009

Effects of ivermectin and albendazole on some liver and kidney function indices in rats R. O. Arise and S. O. Malomo Full Length Research Paper Evaluation of repeated administration of ivermectin and albendazole separately and in combination on some hepatic and renal function indices were examined in albino rats (Rattus novergicus). The experimental animals were randomly divided into four groups: those administered distilled water (control), those administered 0.4 mg/kg bodyweight of ivermectin (Iver), those administered 15 mg/kg body weight of albendazole (Alb) and those administered the two drugs concurrently (Iver+Alb). The animals were administered, the drugs daily for fifteen days after which venous blood, liver and kidney were collected. The separate administration of ivermectin and albendazole significantly elevated (Plt;0.05) the concentrations of serum potassium and bicarbonate ions. Also, their co-administration caused a significant elevation (Plt;0.05) of serum phosphate ion concentration. Administration of ivermectin and/or albendazole led to significant increase (Plt;0.05) in serum urea, creatinine, glucose and cholesterol concentrations while albumin was significantly reduced (Plt;0.05). Generally, activities of ALP, ACP, LDH, AST, ALT, Na+-K+ATPase and Ca2+-Mg2+ ATPase of liver and kidney were significantly altered (Plt;0.05). These observations may be suggestive of deranged membrane structures and functions. Thus the combined administration of the two drugs may be exerting more deleterious effects on both renal and hepatic functions than when administered individually. Key words: Ivermectin, albendazole, liver function, kidney function. Academic Journals 2009 TEXT text/html https://academicjournals.org/journal/AJBR/article-abstract/E62326811023 http://dx.doi.org/10.5897/AJBR.9000102 en Copyright © 2009 R. O. Arise and S. O. Malomo 2024-07-28T01:34:08Z|100|oai_dc|ajbr