Full Length Research Paper
ABSTRACT
Rice is sensitive to salt stress, but its sensitivity varies among genotypes, indicating natural variation in regulatory mechanisms and genetic makeup. High-affinity potassium transporters (HKTs) that transport cations across membranes play important roles in stress responses of plants. In this study, the gene sequence polymorphisms and expression level of OsHKT1;3 which is a member of the rice HKT gene family was assessed. Sequence analysis indicated 5 single nucleotide polymorphisms (SNPs) in the coding sequence; 4 nucleotide substitutions, one nucleotide deletion and one nucleotide insertion in the promoter region of OsHKT1;3 gene. Among 5 SNPs in the coding sequence, one was non-synonymous (C598G) which caused the change in amino acid L200V and 4 were synonymous substitutions (A798C, G2083A, T2101C, C2122T). The substituted amino acid L200V was predicted to locate in the third transmembrane segment of OsHKT1;3 protein. In the promoter region, 3 nucleotide substitutions at position -879, -453, and -202 caused the change in cis-elements with 8 deletions and 3 additions. Expression levels of OsHKT1;3 were analyzed in the leaves and the roots under 2 different salt concentrations and showed a tendency of reduction in most of the conditions.
Keywords: OsHKT1;3, salt stress, rice, polymorphism.
INTRODUCTION
Salt stress is a severe abiotic stress reducing the productivity of crop plants. Salinity affects plant growth by both osmotic and ionic stresses (Zhu, 2002; Tester and Davenport, 2003; Bressan et al., 2009). To overcome with the toxicity of elevated Na+ level, plants developed different mechanisms to regulate the Na+ content by minimizing Na+ influx into cells, maximizing Na+ efflux out of the cells, and promoting Na+ sequestration into the vacuole. These activities are mediated by specific transporters (Chinnusamy et al., 2005).
High-affinity potassium transporters (HKTs) are plant- specific proteins that transport cations across membranes (Almeida et al., 2013). The HKT gene family is segregated into 2 sub-classes. Class 1 consists of Na+-selective transporters having a serine at the first pore domain, whilst members of class 2 have a glycine at this position (with an exception of OsHKT2;1) and comprise transporters permeable to Na+ and K+ (Platten et al., 2006; Hauser and Horie, 2010). The gene number of class I differs amongst plants (Garciadeblas et al., 2003; Huang et al., 2008). Though arabidopsis has only one AtHKT1;1 gene, rice contains 4 to 5 depending on cultivar, including OsHKT1;1, OsHKT1;2, OsHKT1;3, OsHKT1;4 and OsHKT1;5 (Garciadeblas et al., 2003; Platten et al., 2006). Some members of the class I play roles in salt tolerance of the plants by retrieving Na+ from the xylem sap and preventing Na+ to accumulate in the shoots (Berthomieu et al., 2003; Byrt et al., 2007; Sunarpi et al., 2005; Ren et al., 2005; Sun et al., 2018), and by excluding Na+ from leaf blades (Cotsaftis et al., 2012; Wang et al., 2015; Suzuki et al., 2016; Kobayashi et al., 2017).
Natural genetic polymorphisms are proven to contribute to stress tolerance in plants. Hence, investigation of these natural variations helps to illustrate the underlying mechanisms of stress responses (Baxter et al., 2010; Brady et al., 2005; Rus et al., 2006). In the report of Ren et al. (2005) by using a population derived from the salt-tolerant cultivar Nona Bokra and the salt-sensitive cultivar Koshihikari, they could identify OsHKT1;5 as the candidate gene for salt QTL and the allelic variation of the Nona Bokra potentially contributed to an increase in Na+ transport activity. Later, Cotsaftis et al. (2012) proved that the V395L substitution present in OsHKT1;5 transporter protein of Nona Bokra could be responsible for the change in Na+ transport activity. Additionally, in the study of Negrão et al. (2013) other two substitutions in OsHKT1;5 were shown to be significantly associated with salt-tolerance related traits. By analyzing genetic variation of OsHKT2;1 gene in a collection of 49 rice cultivars, Oomen et al. (2012) identified in total nine SNPs, but no considerable effect on transport properties was found. However, a new rice HKT OsHKT2;2/1gene was identified in the highly salt-tolerant cultivar Nona Bokra (Oomen et al., 2012). Recently, using a rice diversity panel for genome-wide association mapping, Campbell et al. (2017) detected three non-synonymous variants within OsHKT1;1 gene associated with altered Na+ accumulation in the root. Using the same approach of association mapping, Jiang et al. (2018) could detect 2 SNPs present in the coding region of ZmHKT1;5 which were significantly associated with salt tolerance in maize.
OsHKT1;3 is a member of class I of HKT gene family in rice. This gene is expressed in both the roots and the leaves and encodes protein which transports selectively Na+ (Jabnoune et al., 2009). Till now, to our knowledge, there is only one study on the nucleotide polymorphisms of OsHKT1;3 gene sequence which focused on wild rice (Mishra et al., 2016). Hence, in this study, variations in the OsHKT1;3 gene sequence including the promoter region using different rice genotypes was analyzed. The polymorphisms present in the coding and the promoter sequences were further analyzed in silico to elucidate the potential effect on either protein properties or transcriptional regulatory via cis-regulatory elements, respectively. The expression profile of OsHKT1;3 gene in the roots and the leaves under different salt conditions were analyzed using real-time RT-PCR.
MATERIALS AND METHODS
Plant cultivation and salt treatment
Seeds of 7 rice (Oryza sativa L.) cultivars, consisting of Nipponbare, Chiem Rong, Nuoc Man 1, Nuoc Man 2, Cuom 2, Chanh Trui, and Pokkali, were kindly supplied by Vietnam National University of Agriculture (Hanoi, Vietnam). The seeds were germinated for 4 days. Then, the rice seedlings were grown in Yoshida solution (Yoshida, 1976) and placed either in a greenhouse for phenotyping or in a growth chamber (12 h days with 500 μE m-2 s-1 at 26°C and 12 h night at 22°C) for gene expression analysis. The growth media were renewed every week. After 14 days of normal growth, the media were replaced for media with the appropriate salt concentrations (0, 50, and 100 mM NaCl). Stress treatment was performed for 7 days at 50 and 100 mM NaCl in a gene expression experiment, and for 14 days at 100 mM NaCl in phenotyping experiment.
Evaluation of salt tolerance
The leaf scoring was performed for salt-treated plants based on modified standard evaluation score (SES) of visual injury symptom at seedling stage of rice as described in Gregorio et al. (1997) and Bado et al. (2016).
Total DNA extraction from the leaves
The DNA extraction was carried out using the CTAB method. About 200 mg leaf powder was thoroughly mixed with 500 µL CTAB buffer. After incubating at 65°C for 20 min, 500 µL CI (chloroform: isoamylalcohol) was added. The collected supernatant was mixed with cold isopropanol for 15 min. After centrifugation, the DNA pellet was collected and washed with 70% ethanol. Then, the DNA pellet was left to dry at room temperature. The DNA was dissolved in Tris-EDTA buffer and stored at -20°C for further usage.
Amplification of entire OsHKT1;3 gene by PCR
The 1942-bp promoter fragment and 2465-bp fragment covering entire gene sequence of OsHKT1;3 were amplified separately from genomic DNA material by PCR technique. Primers used for amplifying the OsHKT1;3 coding sequence are cds-FW (5′- CACCACTAACTCTTTGATGCTGA-3′) and cds-RW (5′- GCTAAGCTCGAATCTGTCGC-3′); and for amplifying the OsHKT1;3 promoter region are Pro-FW (5′- TCGTCTAAAGGATGGCAATGA -3′) and Pro-RW (5′- CAGCAAAGGAGATCAGGGCAA-3’). The PCR reaction contained DNA (20 to 50 ng), dNTPs mixture (0.2 mmol/L), MgCl2 (1.5 mmol/L), primers (0.4 µmol/L), Dream Taq polymerase (1 U), and Dream Taq polymerase buffer (1×). The thermal cycle of PCR reaction was 95°C for 5 min, 35 cycles of 95°C for 30 s, 58°C (cds primers)/59°C (promoter primers) for 30 s and 72°C for 2 min, and 72°C for 5 min. Then, 5 µL of PCR products were run on 1% agarose gel. After purified using GeneJET PCR Purification Kit (Thermo Fisher Scientific), the PCR products were sent to the First BASE DNA sequencing service (Singapore) for sequencing. The sequences were submitted to GenBank database under accession numbers MH727499 for Nipponbare cds, MH727500 for Nuoc Man 2 cds, MH727501 for Chiem Rong cds, MH727502 for Nuoc Man 1 cds, MH727503 for Chanh Trui cds, MH727504 for Cuom 2 cds, MH727505 for Pokkali cds, MH727492 for Nipponbare upstream region, MH727493 for Chiem Rong upstream region, MH727494 for Nuoc Man 1 upstream region, MH727495 for Nuoc Man 2 upstream region, MH727496 for Cuom 2 upstream region, MH727498 for Chanh Trui upstream region, and MH727497 for Pokkali upstream region.
Sequence analysis
Bioedit (Hall, 1999), Multalin webserver (Corpet, 1988), and Expasy web server (http://web.expasy.org/translate/) were used to analyzed sequences. The coding and promoter sequences of OsHKT1;3 of all cultivars were compared to those of Nipponbare.
Construction of 3D model of OsHKT1;3 protein
The PHYRE2 program (Kelley et al., 2015) and SWISS-MODEL (http://swissmodel.expasy.org; Biasini et al., 2014) were used to predict the 3D model of OsHKT1;3 protein. The discovery studio 4.5 visualizer was used to visualize the protein structure.
Prediction of putative cis-regulatory elements in the promoter regions of OsHKT1;3
Nipponbare 2-kb upstream sequence from the start codon of OsHKT1;3 gene was taken from the MSU rice genome annotation database (http://rice.plantbiology.msu.edu/; Kawahara et al., 2013) (this region was re-sequenced in this study also). The putative cis-elements present in the promoter regions of Nipponbare and other cultivars were predicted by using PLACE database (Higo et al., 1999; http://www.dna.affrc.go.jp/PLACE/).
RNA isolation and first-strand cDNA synthesis
The leaves and the roots of both control and salt-stressed seedlings were harvested at days 1, 3, and 7 of salt treatments. The leaf/root materials of different plants per cultivar and treatment were homogenized using a ball mill (Mixer Mill MM 400, Retsch, Germany) and equally pooled. Total RNA was extracted using GeneJET Plant RNA purification Kit (Thermo Fisher Scientific, USA). RNA concentration was examined photometrically using NanoDrop ND-1000 UV-Vis spectrophotometer (Nanodrop Technologies, Wilmington, DE). The genomic DNA was removed by using DNase I (Thermo Fisher Scientific, USA) and the absence of DNA was checked by PCR for amplification of OsHKT2;1 intron sequence (FW: 5’-ATCATCAGGTGTGTTCCTCTCTC-3’, RW: 5’-CATTGGCTTGATGCCCAGTGT-3’). 1 µg of purified RNA was used to transcribe into cDNA using Revert-Aid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, USA).
Quantitative real-time PCR for gene expression analysis
The transcript levels of OsHKT1;3 gene in different samples were quantified by real-time PCR analysis using specific primers for OsHKT1;3 (FW: 5’- TTTGCATCACAGAACGGGAC-3’, RW: 5’- TCCATATGCACTGACGACTTC-3’). The reference gene, Actin1, was used to normalize variance in the amount of input cDNA. Each real-time PCR reaction contained 1 µL of diluted cDNA, 10 µL of SYBR Green Master Mix 2X (Luminaris Higreen low ROX qPCR master mix, Thermo Fisher Scientific, USA), 0.6 µL of primer mix (10 μM) in a total reaction volume of 20 μL. The thermal cycle of PCR was performed as: 95°C for 10 min, 40 cycles of (95°C for 15s, 60°C for 1 min) in 96-well optical reaction plates employing ABI Fast 7500 System (Applied Biosystems, Foster City, CA). The relative mRNA levels of OsHKT1;3 gene (described as fold change) in different samples were computed using the 2-∆∆Ct method as described previously by Livak and Schmittgen (2001).
RESULTS
Classification of salt tolerance
The rice plants were subjected to salt stress at the vegetative stage using hydroponic culture. The modified standard evaluation score (SES) of visual injury symptom at seedling stage has been proven to be the reliable parameter for discriminating amongst the susceptible, the tolerant, and the moderate groups (Gregorio et al., 1997). Thus, in this study, modified SES was used for classification of salt tolerance of rice. As shown in Table 1, the cultivars Pokkali, Chanh Trui, Cuom 2, and Nuoc Man 1 were classified as salt-tolerant; while Chiem Rong and Nuoc Man 2 were moderate. Nipponbare was sensitive.
Polymorphisms in the coding sequence of OsHKT1;3 gene
The OsHKT1;3 gene sequence is 2325 bp in length with 3 exons and 2 introns. To investigate the genetic variation in the OsHKT1;3 coding sequence, the entire gene sequence of OsHKT1;3 was amplified by PCR using specific primers. The amplified DNA fragments were further sequenced allowing the detection of five SNPs in the coding sequence (Figure 1). Among 5 SNPs in the coding sequence, one was non-synonymous (C598G) and 4 were synonymous substitutions (A798C, G2083A, T2101C, C2122T). These variants were found in Chanh Trui, and Nuoc Man 1.
The non-synonymous C598G led to the amino acid change of L200V. To elucidate the putative effect of the non-synonymous (C598G) on protein structure, the 3D molecular model of OsHKT1;3 transporter was predicted and the position of substituted amino acid L200V on protein domains was analyzed. The 3D models of OsHKT1;3 shows the presence of 3 glycine residues (Gly247, Gly371, and Gly471) and one serine residue (Ser93) forming a selectivity filter (Figure 2B). The substituted amino acid (L200V) locates in the third transmembrane segment of OsHKT1;3 (Figure 2A and C). It was concluded that this substitution unlikely interferes with the capacity of Na+ transport of the variant OsHKT1;3 transporter.
OsHKT1;3 gene upstream region polymorphism
The 1942-kb upstream region from the start codon of OsHKT1;3 was amplified by PCR following direct sequencing. By comparing the obtained sequences, 4 nucleotide substitutions (T-7C, T-202C, A-453G, and G-879A), one deletion of T at position -821, and one addition of A at position -127 in the upstream sequence of OsHKT1;3 gene were identified (Figure 1). To dissect the consequent effect of polymorphisms on transcriptional regulatory functions of the promoter, the cis-elements were predicted using PLACE database. It has been shown that the nucleotide substitution at position -202 and -453 caused deletions of 3 cis-elements, consisting of 2 CAATBOX1 and one RAV1AAT (Table 2); while nucleotide substitution at position -879 caused replacement of 5 cis-elements by other 3 cis-elements involving to stress responses (Table 2). The changes in cis-elements occurred in only cultivar Pokkali.
Expression profile of OsHKT1;3 gene
Expression analysis of OsHKT1;3 gene was carried out using Real time RT-PCR in 2 rice cultivars, namely Pokkali and Nippponbare, under control and salinity conditions (50 and 100 mM NaCl) to determine the different responses in expression level of OsHKT1;3 gene. As shown in Figure 3, the expression of OsHKT1;3 gene was decreased in both leaf and root samples of both rice cultivars. The reduction in expression of OsHKT1;3 was more pronounced in the roots than in the leaves.
DISCUSSION
Rice (O. sativa L.) is an important crop, but its productivity has been limited by salinity. Investigation of novel genes/alleles for salt tolerance in rice is of necessity. In this study, the natural allelic variation in sequence and expression of rice OsHKT1;3 encoding the Na+- selective transporter belonging to HKT family using rice cultivars varying in salt-tolerant levels was explored (Table 1). In total, eleven nucleotide variations were identified in the gene sequence and the upstream region of the OsHKT1;3 (Figure 1).
In the coding sequence of the gene, one non-synonymous substitution (C598G) was detected, leading to an amino acid substitution (L200V). It has been previously reported that SNPs in the coding sequence of HKT genes affect the functions of transporters and associated with salt-tolerant traits (Rubio et al., 1995; Ren et al., 2005; Baxter et al., 2010; Ali et al., 2016; Mishra et al., 2016; Campbell et al., 2017; Jiang et al., 2018). Therefore, the 3D models of OsHKT1;3 was predicted to elucidate the putative effect of the C598G polymorphism on functions of the variant transporter. In the predicted protein model, 4 amino acid residues, including 3 glycine and one serine, which form a selectivity filter were identified (Figure 2B). That structure determines the Na+-selective transport property of OsHKT1;3, which agrees with the finding of the highly selective Na+ transporter of OsHKT1;3 reported by Jabnoune et al. (2009). The substituted amino acid L200V locates in the third transmembrane domain (Figure 2A and C), and is unlikely to interfere with Na+ transport in the variant transport.
The upstream region of the gene, where the cis-elements present, plays important roles in controlling the expression of the gene. Identification of cis-elements may elucidate expression patterns of the gene (Mariño-Ramírez et al., 2009). Thus, variation in the cis-element
number and pattern in the upstream region of the rice cultivars can have a decisive impact on OsHKT1;3 gene expression, and thereby on a response of plants to salt stress. In the current study, in total 4 nucleotide substitutions (T-7C, T-202C, A-453G, and G-879A), one deletion of T occurred at site -821, and one addition of A at position -127 were detected in the upstream sequence of OsHKT1;3 gene (Figure 1). Further in silico analysis revealed that the nucleotide substitution at position -202 and -453 caused deletions of 3 cis-elements, consisting of 2 CAATBOX1 and one RAV1AAT (Table 2). The cis-element CAATBOX1 determines tissue-specific activity of the promoter (Shirsat et al., 1989), while RAV1AAT is the binding site of the transcription factor RAV1 (Kagaya et al., 1999). The nucleotide substitution at position -879 caused replacement of 5 cis-elements, including CAATBOX1, WBOXATNPR1, WBOXHVISO1, WBOXNTERF3, and WRKY71OS, by other 3 cis-elements, consisting of MYB2AT, MYB2CONSENSUSAT, and MYBCORE (Table 2). The 3 replacing cis-elements (MYB2AT, MYB2CONSENSUSAT, and MYBCORE) are involved in water stress responses (Abe et al., 2003; Urao et al., 1993); while the 5 replaced cis-elements CAATBOX1, WBOXATNPR1, WBOXHVISO1, WBOXNTERF3, and WRKY71OS have different roles. CAATBOX1 is responsible for tissue-specific promoter activity (Shirsat et al., 1989); while WBOXATNPR1, WBOXHVISO1, WBOXNTERF3, and WRKY71OS are responsible for salicylic acid, sugar, wounding and gibberellin, respectively (Yu et al., 2001; Sun et al., 2003; Nishiuchi et al., 2004; Zhang et al., 2004). These cis-element changes might affect the expression pattern of OsHKT1;3 gene in response to stress conditions.
Since the polymorphisms in the upstream region of OsHKT1;3 gene that lead to the changes in cis-elements occurred only in salt-tolerant cultivar Pokkali, then the difference in gene expression response to salt stress of 2 contrasting rice cultivars, Pokkali and Nipponbare were next examined. The results showed that OsHKT1;3 gene expression was decreased in both leaves and roots samples of both rice cultivars (Figure 3). In the previous study, the OsHKT1;3 gene was found to express in both the roots and the mature leaves (Jabnoune et al., 2009; Abdulhussein et al., 2018). The expression of OsHKT1;3 gene in the roots and the leaves was not changed upon the different growth conditions (Jabnoune et al., 2009).
OsHKT1;3 is found to be located in the Golgi membrane, not in the plasma membrane (Rosas-Santiago et al., 2015). OsHKT1;3 can mediate both inward and outward currents but displays weak inward rectification in Xenopus oocytes (Jabnoune et al., 2009). Thus, it might be that the reduced expression of OsHKT1;3 under salinity conditions help decrease the transport of Na+ from Golgi to the cytoplasm, which in turn protects the cell from the toxicity of accumulated Na+ in the cytoplasm. This hypothesis is supported by the findings of Rosas-Santiago et al. (2015) that the yeast is more susceptible to Na+ when the OsHKT1;3 is expressed.
In conclusion, polymorphisms were detected in the coding and promoter sequences of OsHKT1;3 gene of the salt-tolerant cultivars (Pokkali, Chanh Trui, Cuom 2, and Nuoc Man 1), but not of the moderate cultivars (Chiem Rong, Nuoc Man 2) and sensitive cultivar Nipponbare. Amongst those polymorphisms, SNP C598G caused the change in amino acid L200V in tolerant cultivars Chanh Trui and Nuoc Man 1; and SNP G-879A led to the addition of several water stress related cis-elements in the tolerant cultivar Pokkali which showed more reduction in OsHKT1;3 expression level in the roots than that of the sensitive cultivar Nipponbare. Thus, it shall be useful to further characterize these 2 SNPs to demonstrate their decisive roles in salt tolerance. Site-directed mutagenesis study using modern techniques such as CRISPR-Cas9 would help resolve whether SNP C598G affects transport activity of protein or SNP G-879A alters gene expression level, which subsequently clarifies the roles of these 2 SNPs to plant stress tolerance. Rice plants responded to salinity by reducing the expression of OsHKT1;3 gene.
CONFLICT OF INTERESTS
The authors have not declared any conflict of interests.
ACKNOWLEDGEMENT
This research is funded by Vietnam National Foundation for Science and Technology Development (NAFOSTED) under the grant number 106-NN.02-2013.47 for Phuc Thi Do.
REFERENCES
|
Abdulhussein FR, Mutlag NH, Sarheed AF (2018). Genotypic characterization and tissue localization of the mutant lines expression of HKT1;3 gene in rice under salt stress. Plant Archives 18(1):489-495. |
|
|
Abe H, Urao T, Ito T, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2003). Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling. Plant Cell 15:63-78. |
|
|
Ali A, Raddatz N, Aman R, Kim S, Park HC, Jan M, Baek D, Khan IU, Oh DH, Lee SY, Bressan RA, Lee FW, Maggio A, Pardo JM, Bohnert HJ, Yun DJ (2016). A single amino-acid substitution in the sodium transporter HKT1 associated with plant salt tolerance. Plant Physiology 171(3):2112-2126. |
|
|
Almeida P, Katschnig D, Boer AH (2013). HKT trasporter- state of the art. International Journal of Molecular Sciences 14:20359-20385. |
|
|
Bado S, Forster BP, Ghanim AMA, Jankowicz-Cieslak J, Berthold G, Luxiang L (2016). Protocols for pre-field screening of mutants for salt tolerance in rice, wheat and barley. Springer International Publishing AG Switzerland. P. 37. |
|
|
Baxter I, Brazelton JN, Yu D, Huang YS, Lahner B, Yakubova E, Li Y, Bergelson J, Borevitz JO, Nordborg M, Vitek O, Salt DE (2010). A coastal cline in sodium accumulation in Arabidopsis thaliana is driven by natural variation of the sodium transporter AtHKT1;1. PLoS Genetics 6:e1001193. |
|
|
Berthomieu P, Conejero G, Nublat A, Brackenbury WJ, Lambert C, Savio C, Uozumi N, Oiki S, Yamada K, Cellier F., Gosti F, Simonneau T, Essah PA, Tester M, Véry AA, Sentenac H, Casse F (2003). Functional analysis of AtHKT1 in Arabidopsis shows that Na+ recirculation by the phloem is crucial for salt tolerance. EMBO Journal 22:2004-2014. |
|
|
Biasini M, Bienert S, Waterhouse A, Arnold K, Studer G, Schmidt T, Kiefer F, Cassarino TG, Bertoni M, Bordoli L, Schwede T (2014). SWISS-MODEL: modelling protein tertiary and quaternary structure using evolutionary information. Nucleic Acids Research 2(W1):W252-W25. |
|
|
Brady KU, Kruckeberg AR, Bradshaw Jr HD (2005). Evolutionary ecology of plant adaptation to serpentine soils. Annual Review of Ecology, Evolution, and Systematics 36:243–266. |
|
|
Bressan R, Bohnert H, Zhu JK (2009). Abiotic stress tolerance: from gene discovery in model organisms to crop improvement. Molecular Plant 2(1):1-2. |
|
|
Byrt CS, Platten JD, Spielmeyer W, James RA, Lagudah ES, Dennis ES, Tester M, Munns R (2007). HKT1;5-like cation transporters linked to Na+ exclusion loci in wheat, Nax2 and Kna1. Plant Physiology 143:1918-1928. |
|
|
Campbell MT, Bandillo N, Al Shiblawi FRA, Sharma S, Liu K, Du Q, Schmitz AJ, Zhang C, Anne-Alienor V, Lorenz AJ, Walia H (2017). Allelic variants of OsHKT1;1 underlie the divergence between indica and japonica subspecies of rice (Oryza sativa) for root sodium content. PLoS Genetics 13:e1006823. |
|
|
Chinnusamy N, Jagendorf A, Zhu JK (2005). Understanding and improving salt tolerance in plants. Crop Science 45:437-448. |
|
|
Corpet F (1988). Multiple sequence alignment with hierarchical clustering. Nucleic Acids Research 16(22):10881-10890. |
|
|
Cotsaftis O, Plett D, Shirley N, Tester M, Hrmova M (2012). A two-staged model of Na+ exclusion in rice explained by 3D modeling of HKT transporters and alternative splicing. PLoS ONE 7:e39865. |
|
|
Garciadeblas B, Senn ME, Banuelos MA, Rodriguez-Navarro A (2003). Sodium transport and HKT transporters: The rice model. Plant Journal 34:788-801. |
|
|
Gregorio GB, Senadhira D, Mendoza RD (1997). Screening rice for salinity tolerance. IRRI Discussion paper series no. 22, IRRI, Manila P. 30. |
|
|
Hall TA (1999). BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic acids Symposium Series 41:95-98. |
|
|
Hauser F, Horie T (2010). A conserved primary salt tolerance mechanism mediated by HKT transporters: A mechanism for sodium exclusion and maintenance of high K+/Na+ ratio in leaves during salinity stress. Plant, Cell and Environment 33:552-565. |
|
|
Higo K, Ugawa Y, Iwamoto M, Korenaga T (1999). Plant cis-acting regulatory DNA elements (PLACE) database. Nucleic Acids Research 27:297-300. |
|
|
Huang S, Spielmeyer W, Lagudah ES, Munns R (2008). Comparative mapping of HKT genes in wheat, barley, and rice, key determinants of Na+ transport, and salt tolerance. Journal of Experimental Botany 59:927-937. |
|
|
Jabnoune M, Espeout S, Mieulet D, Fizames C, Verdeil JL, Conéjéro G, Rodríguez-Navarro A, Sentenac H, Guiderdoni E, Abdelly C, Véry AA (2009). Diversity in expression patterns and functional properties in the rice HKT transporter family. Plant Physiology 150:1955-1971. |
|
|
Jiang Z, Song G, Shan X, Wei Z, Liu Y, Jiang C, Jiang Y, Jin F, Li Y (2018). Association analysis and identification of ZmHKT1;5 variation with salt-stress tolerance. Frontiers in Plant Science 9:1485. |
|
|
Kagaya Y, Ohmiya K, Hattori T (1999). RAV1, a novel DNA-binding protein, binds to bipartite recognition sequence through two distinct DNA-binding domains uniquely found in higher plants. Nucleic Acids Research 27(2):470-478. |
|
|
Kawahara Y, de la Bastide M, Hamilton JP, Kanamori H, McCombie WR, Ouyang S, Schwartz DC, Tanaka T, Wu J, Zhou S, Childs KL, Davidson RM, Lin H, Quesada-Ocampo L, Vaillancourt B, Sakai H, Lee SS, Kim J, Numa H, Itoh T, Buell CR, Matsumoto T (2013). Improvement of the Oryza sativa Nipponbare reference genome using next generation sequence and optical map data. Rice 6:4. |
|
|
Kelley LA, Mezulis S, Yates CM, Wass MN, Sternberg MJE (2015). The Phyre2 web portal for protein modeling, prediction and analysis. Nature Protocols 10:845–858. |
|
|
Kobayashi NI, Yamaji N, Yamamoto H, Okubo K, Ueno H, Costa A, Tanoi K, Matsumura H, Fujii-Kashino M, Horiuchi T, Nayef MA, Shabala S, An G, Ma JF, Horie T (2017). OsHKT1;5 mediates Na+ exclusion in the vasculature to protect leaf blades and reproductive tissues from salt toxicity in rice. Plant Journal 91(4):657-670. |
|
|
Livak KJ, Schmittgen TD (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2-∆ method. Methods 25:402-408. |
|
|
Mari-o-Ramírez L, Tharakaraman K, Bodenreider O, Spouge J, Landsman D (2009) Identification of cis-regulatory elements in gene co-expression networks using A-GLAM. Methods in Molecular Biology 541:1-22. |
|
|
Mishra S, Singh B, Panda K, Singh P, Singh N, Misra P, Rai V, Singh NK (2016). Association of SNP haplotypes of HKT family genes with salt tolerance in Indian wild rice germplasm. Rice 9:15. |
|
|
Negrão S, Cecília AM, Pires IS, Abreu IA, Maroco J, Courtois B, Gregorio GB, McNally KL, Margarida OM (2013). New allelic variants found in key rice saltâ€tolerance genes: an association study. Plant Biotechnology Journal 11:87-100. |
|
|
Nishiuchi T, Shinshi H, Suzuki K (2004). Rapid and transient activation of transcription of the ERF3 gene by wounding in tobacco leaves: possible involvement of NtWRKYs and autorepression. Journal of Biological Chemistry 279(53):55355-55361. |
|
|
Oomen RJ, Benito B, Sentenac H, Rodrıguez-Navarro A, Talon M, Very AA, Domingo C. (2012). HKT2;2/1, a K+-permeable transporter identiï¬ed in a salt-tolerant rice cultivar through surveys of natural genetic polymorphism. Plant Journal 71(5):750-762. |
|
|
Platten JD, Cotsaftis O, Berthomieu P, Bohnert H, Davenport RJ, Fairbairn DJ, Horie T, Leigh RA, Lin HX, Luan S, Mäser P, Pantoja O, Rodríguez-Navarro A, Schachtman DP, Schroeder JI, Sentenac H, Uozumi N, Véry AA, Zhu JK, Dennis ES, Tester M (2006). Nomenclature for HKT transporters, key determinants of plant salinity tolerance. Trends in Plant Science 11(8):372-374. |
|
|
Ren ZH, Gao JP, Li LG, Cai XL, Huang W, Chao DY, Zhu MZ, Wang ZY, Luan S, Lin HX (2005). A rice quantitative trait locus for salt tolerance encodes a sodium transporter. Nature Genetics 37:1141-1146. |
|
|
Rosas-Santiago P, Lagunas-Gómez D, Barkla BJ, Vera-Estrella R, Lalonde S, Jones A, Frommer WB, Zimmermannova O, Sychrová H, Pantoja O (2015). Identification of rice cornichon as a possible cargo receptor for the Golgi-localized sodium transporter OsHKT1;3. Journal of Experimental Botany 66:2733-2748. |
|
|
Rubio F, Gassmann W, Schroeder JI (1995). Sodium-driven potassium uptake by the plant potassium transporter HKT1 and mutations conferring salt tolerance. Science 270:1660-1663. |
|
|
Rus A, Baxter I, Muthukumar B, Gustin J, Lahner B, Yakubova E, Salt DE (2006). Natural variants of AtHKT1 enhance Na+ accumulation in two wild populations of Arabidopsis. PLoS Genetics 2(12):e210. |
|
|
Shirsat A, Wilford N, Croy R, Boulter D (1989). Sequences responsible for the tissue specific promoter activity of a pea legumin gene in tobacco. Molecular Genetics and Genomics 215(2):326-331. |
|
|
Sun C, Palmqvist S, Olsson H, Borén M, Ahlandsberg S, Jansson C. (2003). A novel WRKY transcription factor, SUSIBA2, participates in sugar signaling in barley by binding to the sugar-responsive elements of the iso1 promoter. Plant Cell 15(9): 076–2092. |
|
|
Sun J, Cao H, Cheng J, He X, Sohai H, Niu M, Huang Y, Bie Z (2018). Pumpkin CmHKT1;1 controls shoot Na+ accumulation via limiting Na+ transport from rootstock to scion in grafted cucumber. International Journal of Molecular Sciences 19(9):2648-2668. |
|
|
Sunarpi, Horie T, Motoda J, Kubo M, Yang H, Yoda K, Horie R, Chan WY, Leung HY, Hattori K, Konomi M, Osumi M, Yamagami M, Schroeder JI, Uozumi N (2005). Enhanced salt tolerance mediated by AtHKT1 transporter-induced Na+ unloading from xylem vessels to xylem parenchyma cells. Plant Journal 4:928-938. |
|
|
Suzuki K, Yamaji N, Costa A, Okuma E, Kobayashi NI, Kashiwagi T, Katsuhara M, Wang C, Tanoi K, Murata Y, Schroeder JI, Ma JF, Horie T (2016). OsHKT1;4-mediated Na+ transport in stems contributes to Na+ exclusion from leaf blades of rice at the reproductive growth stage upon salt stress. BMC Plant Biology 16:22. |
|
|
Tester M, Davenport R (2003). Na+ tolerance and Na+ transport in higher plants. Annals of Botany 91:503-527. |
|
|
Urao T, Yamaguchi-Shinozaki K, Urao S, Shinozaki K (1993). An Arabidopsis myb homolog is induced by dehydration stress and its gene product binds to the conserved MYB recognition sequence. Plant Cell 5(11):1529-1539. |
|
|
Wang R, Jing W, Xiao L, Jin Y, Shen L, Zhang W (2015). The rice high-affinity potassium transporter1;1 is involved in salt tolerance and regulated by an MYB-type transcription factor. Plant Physiology 168:1076-1090. |
|
|
Yoshida S, Forno DA, Cock JH, Gomez KA (1976). Laboratory manual for physiological studies of rice. International Rice Research Institute, pp. 61-62. |
|
|
Yu D, Chen C, Chen Z (2001). Evidence for an important role of WRKY DNA binding proteins in the regulation of NPR1 gene expression. Plant Cell 13(7):1527-1540. |
|
|
Zhang ZL, Xie Z, Zou X, Casaretto J, Ho THD, Shen QJ (2004). A rice WRKY gene encodes a transcriptional repressor of the gibberellin signaling pathway in aleurone cells. Plant Physiology 134(4):1500-1513. |
|
|
Zhu JK (2002). Salt and drought stress signal transduction in plants. Annual Review of Plant Biology 53:247-273. |
|
Copyright © 2024 Author(s) retain the copyright of this article.
This article is published under the terms of the Creative Commons Attribution License 4.0
