African Journal of
Biotechnology

  • Abbreviation: Afr. J. Biotechnol.
  • Language: English
  • ISSN: 1684-5315
  • DOI: 10.5897/AJB
  • Start Year: 2002
  • Published Articles: 12504

Full Length Research Paper

Molecular characterization of capsid protein gene of potato virus X from Pakistan

Arshad Jamal1, Idrees Ahmad Nasir2*, Bushra Tabassum2, Muhammad Tariq2,Abdul Munim Farooq2, Zahida Qamar2, Mohsin Ahmad Khan2, Nadeem Ahmad2, Muhammad Shafiq3, Muhammad Saleem Haider3, M. Arshad Javed4, and Tayyab Husnain1
1Lund Stem Cell Center, Klinikgatan 26, 22184 Lund, Sweden. 2Centre of Excellence in Molecular Biology, University of the Punjab, Lahore, Pakistan. 3Institute of Agricultural Sciences, University of the Punjab, Lahore, Pakistan. 4Faculty of Bioscience and Bioengineering, University Technology, 81310 Skudai, Johor, Malaysia.  
Email: [email protected]

  •  Accepted: 10 August 2012
  •  Published: 13 September 2012

Abstract

Potato (Solanum tuberosum L.) is one of the most economically important vegetable crops in Pakistan. Chlorotic thickness veins spots intermingled with a dark green area, mosaic and decrease in size of the leaves were observed in the Lahore during a survey in 2009. Reverse transcriptase polymerase chain reaction (RT-PCR) based detection conditions were optimized for potato virus X using specific primers 5’-GGCGCAACTCCTGCCACAGC -3’ and 5’- TTGTTGTTCCAGTGATACGA -3’. 613 bp amplicon of capsid protein (CP) gene was amplified, cloned and sequenced (Accession number HE577130). Comparisons as well as phylogenetic reconstructions of CP sequence with PVX sequences retrieved from Genebank showed that the Pakistani PVX isolates (HE577130) has close relationship with USSR isolate. This is the first report on the molecular characterization of full length PVX coat protein sequence infecting potato from Pakistan. Homology of the sequenced gene of PVX with reported genes in Gene Data Bank was observed within the range of 90 and 99.7%. Maximum homology was observed to be 99.7% with the gene (Genebank accession No. M38480 and M72416).

 

Key words: Potato virus X, capsid protein.