Abstract

Potato (Solanum tuberosum L.) is one of the most economically important vegetable crops in Pakistan. Chlorotic thickness veins spots intermingled with a dark green area, mosaic and decrease in size of the leaves were observed in the Lahore during a survey in 2009. Reverse transcriptase polymerase chain reaction (RT-PCR) based detection conditions were optimized for potato virus X using specific primers 5’-GGCGCAACTCCTGCCACAGC -3’ and 5’- TTGTTGTTCCAGTGATACGA -3’. 613 bp amplicon of capsid protein (CP) gene was amplified, cloned and sequenced (Accession number HE577130). Comparisons as well as phylogenetic reconstructions of CP sequence with PVX sequences retrieved from Genebank showed that the Pakistani PVX isolates (HE577130) has close relationship with USSR isolate. This is the first report on the molecular characterization of full length PVX coat protein sequence infecting potato from Pakistan. Homology of the sequenced gene of PVX with reported genes in Gene Data Bank was observed within the range of 90 and 99.7%. Maximum homology was observed to be 99.7% with the gene (Genebank accession No. M38480 and M72416).

Key words: Potato virus X, capsid protein.