Full Length Research Paper
ABSTRACT
INTRODUCTION
Pepper (Capsicum spp.) is one of the most important cultivated vegetables around the world. It is a member of the Solanaceae family that contains almost 2500 species; most of them are edible which gives it a countable economic value (Wien, 1999). One of these species is the bell pepper (Capsicum annuum). A group of genes belonging to the pepper plant had been published by Wang and Bosland (2006). Those genes control the qualities, the hereditary foundation of the mutants/lines, activity mechanisms of genes, gene linkage, molecular markers, and chromosome localization when accessible. The edible part of the pepper plant is the fruit. Therefore, studying its ripening process of fruiting is very important. The bio-chemical components help in the variability development among species that include: adjustment of colors (of chlorophyll, carotenoid, or flavonoid aggregation), textural alteration through variation of cell turgor and cell wall structure and/or synthesis, alterations of sugars, acids and unpredictable profiles that influence nutritious quality, flavor and smell, in addition it improves weaknesses to pathogens. Distinctive types of foods grown from the ground are physiologically characterized by the vicinity (climacteric) or nonattendance (non-climacteric) of expanded breath and amalgamation of the vaporous hormone ethylene at the start of maturation (Lelievre et al., 1997). Therefore, studying this process on a molecular basis may provide better understanding for the fruiting development stages. Constrained data have been published on the likenesses and contrasts between climacteric and non-climacteric fruits on transcriptional and expression levels of the responsible genes. Fruit ripening process is closely similar in both types. The bell pepper is a non-climacteric fruit. The discovery of these genes aided in pointing out the purpose of the maturing components preservation during fruit development. The majority of developmental genes that encode for the ripening process are just regulated in different stages of ripening (Lee et al., 2010). Regardless of the advancement made in Arabidopsis as a model dicot plant, late discoveries demonstrated that flowering and fruit (silique) formation in Arabidopsis are close to those of other plant species (Quinet et al., 2006; Carrari et al., 2007).
The outflow profiles accessed 1100 novel Arabidopsis genes coding for known and putative transcription elements (Tfs) throughout silique improvement through utilizing microarray hybridization. Various leveled bunch investigates uncovered unique expression profiles for the diverse silique developmental stages (De Folter et al., 2004). Many genes discovered that are linked to the fruit ripening in the tomato included the elongation factor-1 alpha (EF-1a), ripening inhibitor (RIN) and expansin proteins (EXP1). These genes are expected to play a major role in most of fruit ripening processes with the majority of the flowering plants (Powell et al., 2003).
MATERIALS AND METHODS
Total RNA extraction
According to Cathala et al. (1983), first mature bell pepper fruit and Arapidoposis samples were homogenized with ice cold extraction buffer [2% hexadecyltrimethyl ammonium bromide (CTAB), 2% polyvinyl pyrrolidinone K 30 (PVP), 100 mMTris-HCl (pH 8.0), 25 mM EDTA, 2.0 M NaCl, and 0.5 g/L spermidine] and ß-mercaptoetanol. The samples were incubated at -20°C for 30 min then centrifuged at 8000 round per min (rpm) in 4°C to obtain the supernatant of the mixture that contained the nucleic acids (both
The amplified transcripts had been cloned using the pGEM®-T vector. A partial-length sequence of the candidate fragments was achieved using an automated DNA sequencer (ABI 377, Perkin Elmer®/ABI, Foster City, CA) using the T7 universal primer. The partial-length sequences were analyzed using the National Center for Biotechnology Information (NCBI), followed by pairwise alignment with the Arabidopsis transcripts using the online CLUSTAL W2 software to compare both sequences: www.ebi.ac.uk/Tools/msa/clustalw2/.
Quantification of the targeted genes using the real-time PCR
Several variables need to be controlled for gene-expression analysis, such as the amount of initial material, enzymatic efficiencies, and the differences between tissues or cells in overall transcriptional activity. For the conduction of the Real-time PCR, this analysis was done using a kinetic PCR instrument (ABI PRISMâ 7900 Sequence Detection System “SDS”); The SYBRâ Green PCR master Mix (PE Applied Biosystemsâ, Foster City, CA, USA). The reaction contained cDNA, 10 nM of the specific primers of the investigated genes, SYBRâ Green PCR Master Mix, and deionized water. The results were analyzed using ABI PRISMâ SDS software (version 2.0), and using the comparative threshold cycle (CT) method (DDCT) for calculations. For data normalization, 18S rRNA gene was used as internal control by the following primers; forward (AGTCATCAGCTCGCGTTGACT) and the reverse ‘ACGGGCGGTGTGTACAAAG’. The target amount was normalized to an endogenous reference and relative to a calibrator (fold differences), is given by 2-DDCT. Using the expression level of target genes in the control tissue as a base line, the expression folds have been detected in the treated ones assuming that both standard and target have same efficiencies (Molestina and Sinai, 2005). Threshold cycle values (Ct) were used, as Ct indicates the PCR cycle number at which the amount of amplified target reaches a fixed threshold in order to convert threshold cycles in copy numbers.
RESULTS
The total RNA of the bell pepper fruits and Arabidopsis siliques were isolated, and visualized on 1.2% form-aldehyde agarose gel electrophoresis (Figure 1a). RT-PCR was applied in order to determine expression of the genes under investigation. The RT-PCR products were dis-played on 1.2% formaldehyde agarose gel electrophoresis (Figure 1b). The amplification of the three genes frag-ments were accurate, distinguishable and in the expected size of the designed primers. The elongation factor -1a gene (EF-1a) in both the bell pepper and Arabidopsis siliques were ≈1,100 bp, the RIN fragments ≈330 bp, and the EXP1 fragments ≈ 720 bp. RNA with high quality had been obtained (Figure 1a) and underwent RT-PCR which displayed on 1.2% formaldehyde formaldehyde agarose gel. It was clear that the targeted DNA visible fragments were of the size expected on 1.2% agarose gel (Figure 1b). P1 represents the lane of the DNA fragment of the Elongation factor -1a gene (EF-1a) in the bell pepper and A1, that of the Arabidopsis. Both have the exact size of ≈1100 bp when juxtaposed with the DNA ladder; P2 lane represents the DNA fragment of the RIN gene which has 330 bp and A2 of the Arabidopsis. In addition to that are P3 A3 lanes: where P3 lane is the DNA fragment of the Expansin gene (EXP1) with a size of roughly 720 bp and A3 of the Arabidopsis.
Partial sequencing of expected differential fragments
Partial-length sequences of each of the positive cDNA clones of the three candidate fragments (EF-1a, RIN and EXP1) had been sequenced using the dideoxynucleotide method (Sanger et al., 1977) as shown in Figure 2. The obtained sequences had been aligned with each other to detect homology between the genes in both plants (Figures 3, 4 and 5). The alignment results show an 88.59% similarity between the sequences of the cDNA fragment of the bell pepper and the Arabidopsis’ EL-1a gene and 100% similarity between the cDNA fragment of the bell pepper and the Arabidopsis’ RIN gene. Finally, there was an 82.73% similarity between the cDNA fragment of the bell pepper and the Arabidopsis’ EXP1 gene.
Accurate normalization of gene-expression levels is an absolute prerequisite for reliable results, especially when the biological significance of subtle gene-expression differences is studied. Still, little attention has been paid to the systematic study of normalization procedures and the impact on the conclusions. The expression folds of the candidate genes were calculated and represented in Figure 6. The used formula for copy number detection was:
Y molecules µL-1 = (Xg µL-1 DNA/ [Length of PCR product in base pairs x 660]) x 6.022 x 1023) which is a simple method for determining the variable values in experimental biology (Reed and Muench, 1938).
DISCUSSION
There have been impressive advances in understanding the progressions connected with fruit development at the physiological, biochemical and molecular levels. These advances incorporate revelations on the components and indicate pathways involved and linked with the methodology of products of the fruit maturation. Late research has uncovered that the few genes that control fruit development and ripening have been conserved through-out the course of advancement. The image formulating indicates plainly the conjunction of ethylene-dependent and ethylene-independent pathways in both categories. It has been indicated unmistakably that numerous controllers of fruit development and maturing are normal to both climacteric and non-climacteric types (Paul et al., 2012). Partial sequencing of the genes under investigation revealed high similarity among the genes in Arabidopsis and bell pepper fruits. The differential display reverse transcriptase-PCR was used to extract EF-1a which is an ethylene-inducible gene (Kendrick and Chang, 2008). However, an 88.59% similarity has been detected between the partial sequence of EF-1a in bell pepper and Arabidopsis (1, 100 bp). Moreover, the expression analysis of EF-1a in the bell pepper was minor in comparison to its expression in the Arabidopsis. The expression studies indicated that the EF-1a gene is ripening-regulated, and illustrated changes in transcript accumulation at different fruit developmental stages. The analysis of transcript accumulation in different organs indicated a compelling bias towards expression in the fruit (Yokotani et al., 2009). However, the RIN fragment sequence had a complete similarity of a 100% to the RIN of the Arabidopsis. The increase of the expression of RIN gene induces the ripening process of the fruits (Tieman et al., 2012). In the case of the EXP1 gene of the bell pepper, it had an 82.73% similarity to the Arabidopsis’. In addition, the gene expression of the bell pepper EXP1 was higher than the gene expression in the Arabidopsis fruit. Regarding the RT-PCR, there is a general consensus on using a single control gene for normalization purposes. Accurate normalization of gene-expression levels is an absolute prerequisite for reliable results, especially when the biological significance of subtle gene-expression differences is studied. Still, little attention has been paid to the systematic study of normalization procedures and the impact on the conclusions (Vandesompele et al., 2002). The Real-time PCR differential regulation results illustrated that LeEF-1a gene was significantly down-regulated in bell pepper in comparison to Arabidopsis. Low expression levels of the EF-1a decreased during fruit ripening process (Pokalsky et al., 1989). Some studies showed high degree of conservation between other previously isolated EF-1a genes which suggested that a fungal EF-1a gene might serve as an appropriate probe for a plant EF-1a cDNA. The study also suggested that EF-1a is a multigene family due to the occurrence of six bands on hybridization with EF-1a probe in southern blot analysis.
The result of the RIN expression levels appeared adjacent in bell pepper and Arabidopsis. However, the level of the expression of RIN in the bell pepper was higher than the Arabidopsis. The expression of RIN increases dramatically during Arabidopsis ripening regardless of the temperature. However, it is influenced by both a developmental and ethylene factors (Bartley and Ishida, 2007). In addition to the expression level of the EXP1 in the bell pepper showed a higher score than Arabidopsis. Over-expression of the LeEXP1 gene resulted in enhanced fruit softening which resulted in an improved texture of the fruit, which may be useful for the tomato processing industry (Kaur et al., 2010). Another study by Fujisawa et al. (2011) found a link between the presence of LeEXP1 and CArG boxes in the promoters of several genes involved in fruit ripening.
CONFLICT OF INTERESTS
The author(s) have not declared any conflict of interests.
REFERENCES
Bartley GE, Ishida BK (2007) Ethylene sensitive and insensitive regulation of transcription factor expression during in vitro tomato sepal ripening. Exp. Bot. 58(8):2043-2051. Crossref |
||||
Carrari F, Asis R, Fernie AR (2007). The metabolic shifts underlying tomato fruit development. Plant Biotechnol. 24:45-55 . Crossref |
||||
Cathala G, Savouret J, Mendez B, West BL, Karin M, Martial JA, Baxter JD (1983). A Method for Isolation of Intact, Translationally Active Ribonucleic Acid. DNA 2:329-335. Crossref |
||||
De Folter S, Busscher J, Colombo L, Losa A, Angenent GC (2004) Transcript profiling of transcription factor genes during silique development in Arabidopsis. Plant Mol. Biol. 56(3):351-366. Crossref |
||||
Fujisawa M, Nakano T, Ito Y (2011). Identification of potential target genes for the tomato fruit-ripening regulator RIN by chromatin immunoprecipitation. BMC Plant Boil. 11:26-31. Crossref |
||||
Kaur P, Samuel DVK, Bansal KC (2010). Fruit-specific over expression of LeEXP1 gene in tomato alters fruit texture. Plant Biochem. Biotechnol. 19(2):177-183. Crossref |
||||
Kendrick MD, Chang C (2008) Ethylene signaling: new levels of complexity and regulation. Curr. Opin. Plant Biol. 11:479-485. Crossref |
||||
Lee S, Eun-Joo C, Young-Hee J, Doil C (2010). Non-climacteric fruit ripening in pepper: increased transcription of EIL-like genes normally regulated by ethylene. Funct. Integr. Genomics 10(1):135-146. Crossref |
||||
Lelievre, Jean-Marc Lelièvre, Alain Latchè, Brian Jones, Mondher Bouzayen, Jean-Claude Pech (1997). Ethylene and fruit ripening. Physiol. Plant. 101-4:727-739. Crossref |
||||
Molestina RE, Sinai AP (2005) Host and parasite-derived IKK activities direct distinct temporal phases of NF-kappaB activation and target gene expression following Toxoplasma gondii infection. J. Cell Sci. 15-118:5785-96. | ||||
Paul V, Pandey R, Srivastava GC (2012). The fading distinctions between classical patterns of ripening in climacteric and non-climacteric fruit and the ubiquity of ethylene. J. Food Sci. Technol. 49-1:1-21. | ||||
Pokalsky AR, Hiatt WR, Ridge N, Rasmussen R, Houck CM, Shewmaker CK (1989). Structure and expression of elongation factor 1 alpha in tomato. Nucleic Acid Res. 17(12):4661-4673. Crossref |
||||
Powell ALT, Kalamaki MS, Kurien PA, Gurrieri S, Bennett AB (2003). Simultaneous transgenic suppression of LePG and LeExp1 influences fruit texture and juice viscosity in a fresh market tomato variety. J. Agric. Food Chem. 51:7450-7455. Crossref |
||||
Quinet M, Dubois C, Goffin MC, Chao J, Dielen V, Batoko H, Boutry M, Kinet JM (2006) Characterization of tomato (Solanum lycopersicum L.) mutants affected in their fl owering time and in the morphogenesis of their reproductive structure. J. Exp. Bot. 57:1381-1390. Crossref |
||||
Reed LJ, Muench H (1938). A simple method of estimating fifty percent endpoints. Am. J. Hyg. 27:493-497. | ||||
Sanger F, Nicklen S, Coulson AR (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74-12:5463-7. | ||||
Tieman DM, McIntyre L, Blandon-Ubeda A, Bies D, Odabasi A, Rodriguez G, van der Knaap E, Taylor M, Goulet C, Mageroy MH, Snyder D, Colquoun T, Moskowitz H, Sims C, Clark D, Bartoshuk L, Klee H (2012) The chemical interactions underlying tomato flavor preferences. Curr. Biol. 22:1-5. Crossref |
||||
Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F (2002). Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3(7):RESEARCH0034. | ||||
Wang D, Bosland PW (2006). The Genes of Capsicum. Hortic. Sci. 41- 5:1169-1187. | ||||
Wien HC (1997). The Physiology of Vegetable Crops. Plant Growth Regul. 27- 2:137-138. | ||||
Yokotani N, Nakano R, Imanishi S, Nagata, M, Inaba A, Kubo Y (2009). Ripening-associated ethylene biosynthesis in tomato fruit is autocatalytically and developmentally regulated. J. Exp. Bot. 60-12: 3433-3442. |
Copyright © 2024 Author(s) retain the copyright of this article.
This article is published under the terms of the Creative Commons Attribution License 4.0