Cassava Mosaic Disease (CMD) in India is caused by two species of virus namely, Indian Cassava Mosaic Virus (ICMV) and Sri Lankan Cassava Mosaic Virus (SLCMV) (Patil et al., 2005). Both the DNA viruses belonging to the bipartite begomovirus genus of the family Geminiviridae, and are transmitted by whitefly Bemisia tabaci Genn. Mixed infection of ICMV and SLCMV is often involved in causing CMD in India (Patil et al., 2005). It is reported that Geminivirus species simultaneously infecting the same plant can lead to very severe yield reductions and even crop failure (Pita et al., 2001; Calvert and Thresh, 2002). Transformation and regeneration of transgenic cassava plants expressing kanamycin resistant gene as selectable marker has been reported by several laboratories (Sarria et al., 1993, 1995, 1997; Li et al., 1996; Raemakers et al., 1996; Schopke et al., 1996; Gonzalez et al., 1998; Taylor et al., 2004; Zhang et al., 2005; Vanderschuren et al., 2007; Bull et al., 2010). However, there is no report so far available for the regeneration as well as stable genetic transformation for Indian cassava varieties.

Several reports have shown that RNA interference (RNAi) is more potent in controlling plant virus than the sense or antisense expression of the viral genes (References). It is now well established that both RNA and DNA viruses can be controlled by RNAi approach. The RNA viruses are effectively controlled by silencing the coat protein gene (Patil et al., 2011; Yadav et al., 2011), whereas, the DNA viruses are effectively controlled by silencing the Rep gene, which is indispensable for DNA replication of virus (Pooggin et al., 2003). As a proof of the concept that RNAi can be engineered to effectively target DNA virus namely, Mung Bean Yellow Mosaic Virus (MYMV-Vig) was demonstrated by Pooggin et al. (2003). Furthermore, a PTGS based strategy to control DNA virus replication was demonstrated when plant cells simultaneously transfected with African Cassava Mosaic Virus (ACMV) and with a synthetic siRNA designed to target the AC1 gene of the virus showed a reduction in the accumulation levels of AC1 mRNA by more than 90% and viral DNA by 70% compared with controls (Vanitharani et al., 2003). The DNA-A of the CMV codes for the AC1 gene, the replication-associated protein gene (or Rep gene), which is indispensable for the replication of virus and disease development. This is the first attempt to develop transgenic cassava resistant to CMG using RNAi approach in India.

Cocultivation

Young immature leaf lobes of 0.5 to 1 cm in size just near to the apical meristem of cassava and green coloured individual mature somatic cotyledons of 1.0 cm in size separated from cluster of germinated somatic embryos (This stage is obtained 20 to 30 days after transfer of somatic embryo into SEIM) were used for cocultivation. These explants were precultured on SEIM for 2 days in dark at 28°CA donor E. coli strain DH5α harbouring the recombinant plasmid, pSCR2 The Agrobacterium strain LBA4404 harbouring the pSCR2 vector was inoculated in 50 ml culture and shaken overnight at 250 rpm in LB medium at 26°C until the OD560 was 1.0. The Agrobacterium culture was then pelleted at 4000 rpm, supernatant discarded and the pellet was resuspended in AAM broth supplemented with 100 µm acetosyringone. Explants (both leaflobes and green cotyledons) were dipped in Agrobacterium solution for 10 min and thoroughly blot dried using sterile Whatmann filter paper. After Agrobacterium infection, the explants were transferred to Cocultivation medium containing MS salts, B5 vitamin, 12 mg/l Picloram, 30 g/l Maltose, 4 g/l Phytagel, 100 µm Acetosyringone, and pH-5.8 and incubated for 48 h in darkness at 26°C. After cocultivation, explants were washed twice with sterile distilled water and once with ½ MS basal salts and vitamins containing 300 mg/l Cefotaxime. Explants were then blot dried on filter paper and transferred to callus induction medium containing MS salts, B5 vitamins, 30 g/l maltose, 12 mg/l Picloram, 300 mg/l Cefotaxime and 30 mg/l Hygromycin as selection agent.

Selection and plant regeneration

After 48 h of cocultivation, the treated explants were kept in SEIM with hygromycin (30 mg/l) and cefatoxime (300 mg/l). The cultures were incubated in the dark at 26°C. Two rounds of selection were done to obtain transformed tissue. The sub culturing was done at 20 days interval. The somatic embryos developed at the end of second subculture in SEIM were transferred to somatic embryo maturation medium. After 20 days on maturation media, mature somatic embryos were transferred to regeneration medium (MS basal salts, MS vitamin, 3% sucrose, 0.4% Phytagel) containing plant growth regulators 0.1 mg/l of BAP, 0.02 mg/l of a-naphthalene acetic acid (NAA) and 0.2 mg/l GA₃). The somatic embryos cultured in regeneration medium were incubated under light with 16/8 photoperiod. Subculture was done every two weeks in fresh regeneration medium and incubated under light. Two to three subcultures were done for shoot regeneration.

Molecular analysis of putative transgenic lines of cassava

Crude DNA was extracted from small leaf bits (2-3 cm) which were ground in a 1.5 ml Microfuge tube containing 300 µl of extraction buffer (200 mM Tris-HCl pH 7.5, 200 mM NaCl, 25 mM EDTA and 0.5% SDS) and acid-washed sand using a pestle. The homogenate was centrifuged at 12,000 rpm for 10 min. Equal volume of isopropanol was added to the supernatant and kept at - 20°C for 20-30 min. after centrifugation at 12,000 rpm for 10 min, pellets were air dried at room temperature and dissolved in 30 µl of 0.1X TE buffer (1.0 mMTris-HCl pH 8.0 and 0.1 mM EDTA pH 8.0; Proebski et al., 1997). The PCR analysis was carried out using 100 ng of genomic DNA in a 20 µl reaction mixture containing 2.0 µl of 10X PCR buffer (50 mMTris-HCl pH 8.8, 50 mMKCl and 1.5 mM MgCl₂), 200 µM of each dNTPs, 1 µl of each primer (forward and reverse) and 2 units of Taq DNA polymerase. The primer sequences used for amplification of hph gene are: Forward primer (H1 - 5'GATCTCCAATCTGCGGGATC3') and Reverse primer (H3- 5'ACTCACCGCGACGTCTGTCG3'). The reactions are carried out in PTC-100 minicycler (MJ Research, USA) with following temperature conditions, pre-incubation period at 94°C for 3 min, leading to 35 cycles of denaturation at 94°C for 1 min, annealing at 55°C for 1 min and synthesis at 72°C for 1 min, followed by extension at 72°C for 5 min. Amplified PCR product (10 µl) was subjected to electrophoresis on a 0.8% agarose gel and visualized under UV light. The SLCMV Rep gene in putative transgenic plants were amplified as using the SLCMV Rep gene specific primers with the following temperature conditions, pre-incubation period at 94 °C for 5 min, leading to 35 cycles of denaturation at 94°C for 1 min, annealing at 60°C for 1 min and synthesis at 72°C for 1 min, followed by extension at 72°C for 5 min.

Genetic transformation of cassava variety H-226 for SLCMV resistance

Selection and plant regeneration

Two explants immature leaf lobes and somatic cotyledons were tried for genetic transformation using agrobacterium strain LBA4404 containing the RNAi- SLCMV Rep gene cassette in pSCR2 with hph as gene selectable marker. Out of 3000 immature leaf lobes co cultivated, 106 calli survived two rounds of Hygromycin (30 mg/l) selection. The resistant embryos when transferred to somatic embryo maturation medium resulted in germination of 64 embryos and further to regeneration medium resulted in regeneration of 40 lines to give a transformation efficiency of 1.6% (Table 2). Out of 500 somatic cotyledons (derived from primary somatic embryos) cocultivated, 24 survived two rounds of Hygromycin (30 mg/l) selection. The resistant embryos when transferred to somatic embryo maturation medium resulted in germination of 18 embryos. The germinated embryos when transferred to regeneration medium resulted in regeneration of 6 shoots giving a transformation efficiency of 1.2% (Table 2). In total, out of the 48 transgenic shoots developed two shoots developed well and were hardened in greenhouse (Figures 2 and 3).

Molecular analysis of putative transgenic cassava plants by PCR

The transgenic plants integrated with the SLCMV Rep-RNAi constructs were analysed using PCR amplification of the selectable marker genes (hygromycin and kanamycin primers) and Rep gene specific primers. The PCR analysis with hph gene specific primers amplified an expected size of 620 bp in all the 8 analyzed putative transgenic lines of cassava variety H-226 (Figure 4B). The Rep gene was amplified by using the Rep reverse and ocs terminator reverse primers. As the ocs gene specific primer will not amplify the Rep gene of infected plants, hence it may be considered that the amplification from these primer combinations is due to true integration of transgene in the transgenic plants. The PCR analysis of transgenic lines with SLCMV Rep gene specific reverse primer and Ocs terminator reverse primer amplified an expected size of 540 bp in all the 8 analyzed transgenic lines (Figure 4A). The putative transgenic plants transformed with SLCMV specific gene silencing construct are showing normal growth and development at in vitro conditions. Further assays on the transgenic plants are under progress.

Agrobacterium-mediated transformations of cassava with developed RNAi constructs were done using the immature leaf lobes and green somatic cotyledon explants. SLCMV specific RNAi-Rep gene cassette was cloned into two binary vectors, one containing the kanamycin resistant gene (nptII) and other containing the hygromycin resistant gene (hph). Initially one of the vectors was used for cocultivation studies. Even though the explant somatic cotyledons were able to survive the Agrobacterium infection those transgenic plants failed during greenhouse hardening. In case of Immature leaf lobes, 50% of the explant turned yellow and dried after Agrobacterium infection, whereas, more than 90% of the cotyledonous explants showed normal growth after infection. The transformation efficiency was more in the case of somatic cotyledons but transgenic recovery were poor. The use of immature leaf lobes for transformation is a laborious process hence ways are under progress to develop friable embryogenic calli which can be preserved for long purpose.

The authors have not declared any conflict of interests.