African Journal of
Biotechnology

  • Abbreviation: Afr. J. Biotechnol.
  • Language: English
  • ISSN: 1684-5315
  • DOI: 10.5897/AJB
  • Start Year: 2002
  • Published Articles: 12267

Full Length Research Paper

Isolation and characterization of two malathion-degrading Pseudomonas sp. in Egypt

Amal E. Saafan
  • Amal E. Saafan
  • Microbiology and Immunology Department, Faculty of Pharmacy, Beni-Suef University, Egypt.
  • Google Scholar
Ahmed F. Azmy
  • Ahmed F. Azmy
  • Microbiology and Immunology Department, Faculty of Pharmacy, Beni-Suef University, Egypt.
  • Google Scholar
Magdy A. Amin
  • Magdy A. Amin
  • Microbiology and Immunology Department and Biotechnology center, Faculty of Pharmacy, Cairo University, Egypt.
  • Google Scholar
Shabaan H. Ahmed
  • Shabaan H. Ahmed
  • Microbiology and Immunology Department, Faculty of Medicine, Assiut University, Egypt.
  • Google Scholar
Tamer M. Essam
  • Tamer M. Essam
  • Microbiology and Immunology Department and Biotechnology center, Faculty of Pharmacy, Cairo University, Egypt.
  • Google Scholar


  •  Received: 13 February 2016
  •  Accepted: 11 July 2016
  •  Published: 03 August 2016

 ABSTRACT

Pseudomonas aeruginosa and Pseudomonas mendocina degrading malathion were studied. Morphological, biochemical and 16S rRNA genes for bacterial identification were selected. Biodegradation of some organophosphorus compounds with the 2 bacterial isolates was determined by high performance liquid chromatography (HPLC). P. aeruginosa strain completely removed diazinon, malathion and fenitrothion, but not chlorpyrifos within 14 days. P. mendocina strain was not able to degrade malathion, diazinon and chlorpyrifos completely and no significant degradation for chlorpyrifos. The bacterial growth curve showed a steady increase in the two bacterial isolates masses during malathion degradation. The highest growth rates were with yeast extract, glucose and citrate for the 2 isolates, but not with phenol. Shaked high inoculum density with incubation at 30°C of malathion bacterial cultures were found to be the optimum conditions for malathion degradation. Bacterial culture extracts subjected to liquid chromatography/mass spectrometry (LC/MS) analysis revealed that the separated products were malathion monocarboxylic acid and malathion dicarboxylic acid. Molecular characterization of carboxylesterase enzyme revealed that carboxylesterase amino acid sequences of the 2 isolates showed high identity to other carboxylesterase enzymes of P. aeruginosa and P. mendocina, respectively. Phylogenetic analysis showed that P. aeruginosa was localized in a separate branch from other carboxylesterase producing Pseudomonas sp. So, it is suggested that this enzyme is a novel esterase enzyme. Use of pesticide-degrading microbial systems for removal of organophosphorus compounds from the contaminated sites requires an understanding of ecological requirements of degrading strains. The results provided an important insight into determining the bioremediation potential of both strains. But the mentioned bacteria cannot be the aim of bioremediation due to risk of public health hazard, hence these bacteria cannot be used in bioremediation but their purified enzymes could.

 

Key words: Biodegradation, carboxylestrase, organopgosphorus pesticides, Pseudomonas aeruginosa, Pseudomonas mendocina.


 INTRODUCTION

Organophosphorus compounds (OPCs) have been used worldwide as plasticizers, petroleum additives and as pesticides since the Second World War. Although, OPCs are biodegradable, they are highly toxic to mammals and other non-target animals (Ragnarsdottir, 2000). Organophosphorus compounds inhibit the acetylcholinestrase resulting in the over-stimulation of acetylcholine receptors in the synapses (Karalliedde and Senanayake, 1988). Overstimulation of acetylcholine receptors at the cholinergic synapses of autonomic, central nervous systems and neuromuscular junctions causes agitation, hypersalivation, confusion, convulsion, respiratory failure and finally, death (Eddleston et al., 2008).

Biodegradation is one of the natural processes that help to remove chemicals from the environment by microorganisms (Singh et al., 2004; Zhao et al., 2009). Most microorganisms, especially bacteria, have detoxifying abilities (transformation, mineralization and/or immobilization of the pollutants) and also play a crucial role in biogeochemical cycles for sustainable development of the biosphere. Organophosphorous compounds are esters; the principal reactions that occur are hydrolysis, oxidation, alkylation and dealkylation. Hydrolysis of P-O-alkyl and P-O-aryl bonds is considered the significant step in microbial detoxification. Hydrolysis of OPCs greatly reduces their mammalian toxicity (Kaneva et al., 1998).

Malathion is a wide spectrum OPC used in public health and agricultural setting. Due to extensive use of malathion, exposure risk of living organisms including human beings is very high. Malathion degradation by microorganisms has been reported by several items (Goda et al., 2010; Singh et al., 2012; Janeczko et al., 2014).   

Co-metabolism is another special phenomenon; it occurs widely in microbial metabolism. Here, the microorganisms transform the desired toxicant compound even though the compound itself cannot work as the primary source of energy for those organisms. To degrade the xenobiotic, the microbes need the presence of primary substrates that can support their growth. The enzymes or coenzymes made to mineralize the primary substrate may possess some activity for other substrate that is significantly known as co-substrate (Karpouzas and Walker, 2000).

There are different types of enzymes responsible for the degradation of OPCs, the most important of them are phosphotriesterases and carboxylesterases (Goda et al., 2010). Carboxylesterases are enzymes found in the α/β-hydrolase fold family that catalyze the hydrolysis of carboxyl esters via the addition of water (Hosokawa et al., 2007). Several researchers isolated and fully characterized carboxylesterase enzymes recovered from different microorganisms (Hosokawa et al. 2007; Li et al., 2007; Goda et al., 2010). Li and colleagues (2007) were able to fuse carboxylesterase enzyme with a green fluorescent protein that made their organism easily detectable in the environment following the degradation of pesticide residues. The main objective of the present study was isolation and molecular identification of bacterial strains capable of degrading some organophosphorus pesticides particularly, malathion and factors affecting its biodegradation. Molecular characterization of the degrading enzymes was also aimed at.


 MATERIALS AND METHODS

Samples collection

Samples were collected from different environmental sites from May 2011 to May 2012, Beni-Suef City, Egypt. Agricultural soil samples were collected by removing about 5 cm of soil surface and 10 cm depth and nearly 50-100 ml of agriculture wastewater and domestic sewage samples, respectively, were collected and stored at 4°C till use.

 

Isolation of degrading organisms from different environmental samples

Organophosphorus compounds (OPCs) such as malathion (MAL), chlorpyrifos (CPF), diazinon (DIZ), and fenitrothion (FEN) were dissolved in the least amount of methanol and completed with water to achieve a concentration of 10 mg ml-1. Ten grams of fine granular soil or 10 ml of sewage water were separately added to 20 mg MAL L-1 in minimal salt medium (MSM), incubated at 30°C in a rotary shaker at 150 rpm. After three successive transfers, the enrichment culture was serially diluted and spread on MSM plates containing 100 mg MAL L-1. Discrete bacterial colonies based on morphological properties were selected and sub-cultured to obtain pure cultures.

 

Inoculum preparation for biodegradation study

As described by Anwar et al. (2009), colony forming units per milliliter (c.f.u ml-1) of this suspension was quantified by the dilution plate count technique and required inoculums were prepared by adding appropriate amount of normal saline.

 

HPLC analysis of organophosphates degradative capacity of the recovered isolates

Degradative capacities of Pseudomonas aeruginosa and Pseudomonas mendocina were carried out by measuring the residual MAL in MSM medium. One hundred milliliter of MSM supplemented with 100 µg MAL ml-1 was inoculated with 1.5 ×108 c.f.u ml-1 bacterial suspension and incubated as mentioned previously for 7 days. Centrifugation to remove bacterial pellets and filter sterilization through 0.22 µm to ensure complete removal of bacterial cells was done. Control experiment was carried out in parallel by 100 ml of MSM with 100 µg MAL ml-1 without being inoculated with bacteria and incubated under the same conditions. Five milliliters aliquot from each of the previously mentioned media were centrifuged at 7200 g for 10 min, and extracted 2 times with 50 ml of dichloromethane by vigorous shaking. Dehydration with anhydrous Na2SO3 and evaporation of dichloromethane extracts with rotary evaporator at 30°C. The dry residues were dissolved in 1 ml acetonitrile and stored at 4°C until HPLC analysis. Twenty microliter of extracted sample were injected in HPLC (Agilent Technologies 1260 Infinity, USA), using Eclipse plus C18 (4.6 ×250 mm 5 μm) and diode array detector (DAD) at λ 210 nm. HPLC working conditions were acetonitrile: water (70:30), at a flow rate 1 ml min-1.

 

Identification of the most active degrader organisms

In addition to morphological and biochemical identification, molecular characterization of bacterial isolates was done (Goda et al., 2010). The DNA extraction was done by GenElute DNA Bacteria Genomic DNA Kit (Sigma-Aldrich, USA). The 16S rRNA gene was amplified using the universal primer pair: 27f (5'-AGAGTTTGATCMTGGCTCAG-3') and 1525r (5'-AAGGAGGTGWTCCARCC-3'), ordered through, and delivered by Invitrogen, USA. Thermal profile of PCR reaction for amplification of 16S rRNA gene for the most active two isolates was done using Dream Taq Green PCR Master Mix (2X) (Thermo Fisher Scientific Inc., USA). PCR products were visualized by placing on UV transilluminator and were photographed directly. Purification of PCR products from gel were done by GeneJET Gel Extraction Kit (Thermo Fisher Scientific Inc., USA) according to manufacturer protocol and purified DNA was stored at -20°C. Sequencing reactions were performed at Clinilab in MJ research PTC-225 Peltier Thermal Cycler using ABI PRISM BigDye Terminator v3.1 Cycle Sequencing Kit with AmpliTaq DNA polymerase, following the protocols supplied by the manufacturer. Single-pass sequencing was performed on each template using the above mentioned primers. The fluorescent-labeled fragments were purified from the unincorporated terminators with an ethanol precipitation protocol. The samples were resuspended in distilled water and subjected to electrophoresis in ABI 3730 x1 sequencer (Applied Biosystem, USA). Nucleotide sequence similarities were determined using other known sequences found in the GenBank database using BLAST program of National Center for Biotechnology Information (NCBI) databases (Ye et al., 2012).

 

Bacterial growth curve and factors that may affect the malathion degradation by P. aeruginosa and P. mendocina

If not otherwise mentioned, the following conditions were adjusted for studying the factors affecting MAL degradation paralleled with control samples at each interval. Each treatment was performed in three replicates. Flasks containing 100 ml of MSM amended with 100 mg MAL l-1 were inoculated with 1.5 ×108 c.f.u ml-1 of isolate and incubated at 30°C on a rotary shaker working at 150 rpm. At different time intervals, samples were taken and then analyzed for the residual MAL concentration by HPLC. Control experiments were carried out in parallel by incubating flasks of the same composition in the same conditions but without addition of the bacteria. These factors included addition of three different carbon sources (glucose, sodium citrate and phenol) and yeast extract as a nitrogen source added separately, at a concentration of 1g l-1 to the culture media. Parallel to measurement of MAL biodegradation, growth curve of the 2 isolates in the presence of the different carbon sources was also measured. Aliquots of 3 ml of bacterial growth culture were withdrawn at different time intervals and monitored by measuring the OD600 with a spectrophotometer (Shimadzu, Japan). To investigate the effect of temperature on biodegradation process, three flasks were incubated at three different temperatures: 25, 30 and 37°C. The effect of inoculum density was investigated using three different inoculum densities: 1.5×104, 1.5×108 and 1.5×1012 c.f.u ml-1. To determine the effect of agitation on MAL biodegradation, two sets were applied, a set of flasks incubated on a rotary shaker and another unshakable one.

 

Detection of degradation metabolites of malathion by LC/MS

One hundred milliliter of MSM supplemented with 100 mg MAL l-1 was inoculated with bacterial cells suspension with a concentration of 1.5 ×108 cf.u ml-1 and incubated at 30°C in orbital shaker at 150 rpm for 7 days. Fifty milliliters aliquot from medium was centrifuged at 7200 g for 10 min to remove the bacterial pellets, and extracted 2 times with 50 ml of dichloromethane by vigorous shaking. Dichloromethane extract was passed through anhydrous Na2SO3 for dehydration, and then evaporated to dryness using rotary evaporator at 30°C. The dry residue was dissolved in 1 ml acetonitrile and submitted for HPLC/MS analysis. The equipment was 6120 Quadrupole LCMS, Agilent Technologies with 1260 Quat Pump VL that was used for metabolites detection according to the following conditions: reversed phase C18 column (15 cm × 2.1 mm I.D., 4 µm) at flow rate of 1 ml min-1 with injection volume of 100 µl and isocratic mobile phase of acetonitrile/water (70/30, v/v). The mass spectrometer was equipped with electrospray ion source operated in positive and negative polarity mode. The electron spray ion mode was operated under the condition of gas temperature of 350°C and drying gas flow of 12.0 l min-1. The nebulizer nitrogen gas was 35 psi with capillary voltage of 3.0 kV. Full scan signal were recorded within the m/z range of 100 to 1000.

 

Molecular characterization of carboxylesterase enzyme responsible for organophosphorus degradation

The sequences of the different carboxylesterase genes for P. aeruginosa and P. mendocina were taken from the NCBI using the online BLASTN program. These sequences were aligned using the multiple sequence alignment tool (ClustalW2) available online (Larkin et al., 2007). Finally, the conserved regions of the genes were determined and then used for primer design. The oligonucleotide primers used in all sets of experiments for carboxylesterase enzyme screening were designed with the online program primer 3 (Ye et al., 2012), corrected manually according to degeneracy of genetic code and ordered from Invitrogen, USA. Primer pairs used in the present study for detection and sequencing of carboxylesterase enzyme for the isolated were: P. aeruginosa; Forward: GTAGTCGTGCCAGCCCAC and reverse: CGAACCCCTGATCCTCGATG with product size 574 bp and annealing temperature 56°C. For P. mendocina, primer pairs were forward: GTG ATG ACG CAG ATG ATC GT and reverse: CCA TCG TTC CAG CAG TCT CA at annealing temperature of 51°C with product size of 766 bp. Primers preparation, PCR reaction conditions, purification of PCR products and sequencing of amplified PCR products were done as mentioned earlier.

 

Phylogenetic analysis of 16S rRNA gene and carboxylesterase gene for the degrading isolates

Sequences of 16S rRNA genes of the isolates were aligned with their homologous sequences using ClustalW2 with default settings (Larkin et al., 2007). Phylogeny was analyzed with MEGA version 6.06 software (Tamura et al., 2013) and distances were calculated using Kimura-2 parameter distance model (Kimura, 1980), while clustering was performed with neighbor-joining method (Saitou and Nei, 1984).

For the carboxylesterase gene sequence, ExPASY translate tool was used to convert sequenced nucleotides to their corresponding amino acids sequences (Gasteiger et al., 2003). The translated amino acids sequences were aligned with their homologous sequences using ClustalW2 with default settings (Larkin et al., 2007). Phylogeny was analyzed with MEGA version 6.06 software (Tamura et al., 2013) and distances were calculated using Poisson model (Ranola et al., 2010) clustering was performed with neighbor-joining method (Saitou and Nei, 1984). 


 RESULTS

Isolation of active organophosphate-degrading bacteria from environmental samples

A total of 18 bacterial isolates were recovered from thirty-six domestic sewage, agricultural wastewater and soil samples collected from different sites in Beni-Suef City, Egypt. The selected isolates were morphologically and biochemically identified. The most common isolated bacteria were Pseudomonas sp. (72.2%), followed by Enterobacter sp. (16.6%). On the other hand, only one isolate (5.6%) was isolated from each of the following bacteria: Serratia sp. and Acinetobacter sp. Regarding the type of the sample, agricultural sewages were the most rich samples with MAL degrading bacteria (49.9%), followed by domestic sewages (38.9%).

 

Morphological, biochemical and molecular identification of the bacterial isolates

According to the morphological and biochemical results, the selected isolates were preliminary identified as P. aeruginosa, isolated from an agricultural sewage sample, and P. mendocina, isolated from domestic sewage, and were abbreviated as PA and PM, respectively. To confirm the identified results, their 16S rRNA genes were amplified from their genomic DNA. Sequence blast showed that strain P. aeruginosa PA had a high similarity (99%) with P. aeruginosa strain ODE5 (Accession number KF420847.1), P. aeruginosa strain NRRLB-59992 (Accession number KF18511.1) and Pseudomonas sp. strain pDL01 (Accession number AF125317.1). P. mendocina PM strain showed a high similarity (99%) with P. mendocina strain FB8 (Accession number HQ701687.1) and P. mendocina strain PC7 (Accession number DQ178223.1).

 

Phylogenetic analysis of 16S rRNA sequences of the selected bacterial isolates

Phylogenetic analysis of 16S rRNA gene sequence of P. aeruginosa strain showed that our strain PA was closely related to P. aeruginosa strain YL 84 that was isolated from compost, a chitinase-producing quorum-sensing bacterium. This study strain was also close to P. aeruginosa strain Pa 24 that was isolated from the Arecanut garden soil of Hannoverin coastal Karnataka, India and showed herbicide biodegradation ability. While, there was a great difference with P. aeruginosa strain LES like 1 (Liverpool epidemic strain) (Jeukens et al., 2014) (Figure 1a). On the other hand, phylogenetic analysis of 16S rRNA gene sequence of P. mendocina strain PM showed that it was the closest to fomesafen-degrading P. mendocina strain FB5, which can grow on a medium with 500 mg l-1 fomesafen herbicide as a sole carbon source but it was not close to some extent to P. mendocina strain PC6, the strain that was able to degrade phenol- and p-cresol, as shown in Figure 1b.

 

 

 

Biodegradation of malathion and other organophosphorus compounds by pure cultures of Pseudomonas sp.

Malathion and other three OPCs (DIZ, FEN and CPF) degradation was monitored at different time intervals and their concentrations were determined using HPLC. The obtained results showed that P. aeruginosa strain PA grew in the presence of MAL with no lag period and the degradation began within the first 24 h from inoculation and completely disappeared on the 14th d of inoculation. The isolate approximately degraded 91% of DIZ within 7 days from inoculation with almost complete removal in the 11th day and 86 and 96% of FEN were degraded within 11 and 14 days, respectively. Only 56% of CFP was degraded within 14 days (Figure 2a). P. mendocina strain PM degradation was less than PA strain where after 24 h from inoculation, only 77.6, 74 and 47% of MAL, DIZ and FEN, respectively, were degraded with no significant degradation for CPF within 14 d of inoculation (Figure 2b).

 

 

 

Different factors affecting degradation of MAL by P. aeruginosa and P. mendocina PM

Factors affecting degradation of MAL by the selected isolates were determined to study the effect of different chemical and physical agents. The bacterial growth curve with OD measurement at 600 nm showed a steady increase in the two bacterial isolates masses. The highest growth rates were with yeast extract, followed by glucose and lastly citrate for the 2 isolates but with phenol and MAL, no significant differences was detected between them (Figure 3).

 

 

Simultaneously, the HPLC analysis was carried out to measure MAL concentration with the different carbon sources. Results of Figure 4a and b showed a substantial reduction in the level of MAL concentration in the 2 bacterial cultures. The isolates were capable of degrading MAL in the presence of other carbon sources greater than MAL consumption alone. For P. aeruginosa strain PA, it was found that after 4 days, PA strain degraded more than 89, 84 and 81% of MAL in the presence of yeast extract, glucose and citrate, respectively, with almost complete removal within 7 days (Figure 4a). Degradation of MAL by PM strain was also greatly enhanced by the addition of yeast extract, glucose or citrate with significant degradation of up to 90, 83 and 72%, respectively, within 7 days of incubation, with complete removal within 14 days. For phenol, there was no significant difference in the presence or absence of phenol with MAL at any time interval with any bacterial culture (Figure 4b).

 

 

The extent of degradation of MAL increased and lag period decreased with increase in the inoculum density to 1.5×1012 c.f.u.ml-1 of both PA and PM (Figure 4c and d). P. aeruginosa PA strain started MAL degradation immediately after inoculation and at the 4th day, the three bacterial inoculums degraded MAL with the same rate. P. mendocina PM strain at a concentration of 1.5 ×104 c.f.u.ml-1 could not degrade MAL at all. On the other hand, bacterial concentration with 1.5×108 and 1.5×1012 c.f.u.ml-1 degraded MAL equally with a lag period of 1 day and after 14 days, the concentration reached 30 mg.l-1 of MAL (Figure 4d).

At 30°C incubation temperature, PA strain completely degraded MAL within 12 days, while in flasks incubatedat 25 and 37°C, almost 86 and 96%, respectively, of MAL were degraded within 14 d (Figure 4e). Upon incubation of PM strain at 25°C, the lag period was extended to 4 days and only 52% of MAL was degraded within 14 day while at 37°C, the lag period was about 2 days and more than 68% of MAL was degraded. At 30°C, it needed only 24 h to start MAL degradation and approximately 80% were degraded at the end of the incubation period (Figure 4f).

P. aeruginosa strain PA in an unshakable state showed a lag phase extended for 24 h, with a decreased biodegradation ability. Shaking of bacterial cultures with 100 mg MAL l-1 resulted in a faster degradation with no shoulder. On the 7th day of incubation, both conditions gave the same rate and extent of degradation and finally disappeared after 14 days of incubation. P. mendocina strain PM in resting condition was unable to show biodegradation ability until 4 days of inoculation and the degradation was hardly affected, where only 32% from the initial concentration of MAL was degraded in 14 days. While, in agitation condition, 44% of initial MAL was degraded within 4 days that increased to about 78% after 14 days of inoculation (Figure 4g-h).

 

Identification of metabolites produced from MAL biodegradation

Bacterial culture extract was subjected to LC/MS analysis to determine the MAL biodegradation metabolites produced from MAL degradation. The spectrum pattern of the separated products showed a molecular ion peak at m/z 330.9 which correspond to MAL. A molecular ion peak at m/z 301 and 274 were observed which is consistent with the molecular formula of malathion monocarboxylic acid (MMC) (C8H15O6PS2) and malathion dicarboxylic acid (MDC) (C6H11O6PS2).

 

Molecular characterization of carboxylesterase enzyme responsible for organophosphorus biodegradation

Malathion monocarboxylic acid, C8H15O6PS2 (MMC) and malathion dicarboxylic acid, C6H11O6PS2, (MDC) as biodegradation metabolites produced during degradation of MAL proved the breaking of ester linkage of the MAL by the bacterium. It was suggested that this isolates might contain carboxylesterase enzymes, so specific primers were designed for their detection. The forward and reverse primers successfully amplified genes of ~550 bp for PA and ~750 bp for PM strain. The translated amino acid sequences were aligned using NCBI protein blast tool on (Figure 5). Carboxylesterase amino acid sequence of P. aeruginosa PA showed 96% identity to carboxylesterase enzyme of P. aeruginosa (WP_003156353.1) and 95% identity to carboxylesterase enzyme of P. aeruginosa (WP_034079889.1). Carboxylesterase of P. mendocina PM showed 94% identity to carboxylesterase enzyme of P. mendocina (WP_013716910.1) and P. mendocina (WP_017362547.1) and 90% identity to carboxylesterase enzyme of P. pseudoalcaligenes (WP_004424218.1). Phylogenetic analysis with MEGA 6.0 software showed P. aeruginosa was localized in a separate branch from other carboxylesterase producing Pseudomonas sp. (Figure 6a). Therefore, it is suggested that this enzyme may be a novel esterase, which differed from those previously reported esterase enzymes. As shown in the Figure 6b, carboxylesterase enzyme of P. mendocina PM was closely related to carboxylesterase enzyme of P. mendocina (WP 013716910), heavy-metal resistant P. mendocina strain isolated from France vineyard soil (Chong et al., 2012).

 

 


 DISCUSSION

Organophosphorus compounds poisoning is a worldwide health problem with about 3 million poisonings and 200,000 deaths annually (Karalliedde and Senanayake, 1988; Sogorb et al., 2004). Bioremediation, which involves the use of microorganisms to detoxify and degrade pollutants, has received increased attention as an effective biotechnological approach to clean up polluted environments. Several chemicals have been successfully removed from soil and aquatic environment using degrading microorganisms such as coumaphos (Mulbry et al., 1996).

In the present study, enrichment culture technique was used to isolate MAL degrading bacteria from polluted samples, where 18 isolates strains were obtained and biochemically identified. Among the isolated Pseudomonas sp., Enterobacter sp., Serratia sp. and Acinetobacter sp., P. aeruginosa and P. mendocina were were found to have the highest capacity for degradation of 100 mg MAL l-1. Accordingly, the results in this study suggested that the enrichment culture technique was well suited for the isolation of physiologically and genetically different strains. Pseudomonades are a diverse group of bacteria that occur in large numbers in soil, where they are active in mineralization of organic matters. In this study, P. aeruginosa strain PA was isolated from agricultural sewage that might be exposed repeatedly to OPCs while, P. mendocina strain PM was isolated from domestic sewage that might not be exposed to OPCs.

Prakash and his colleaagues (1996) observed that a pesticide can be degraded rapidly in the soil from a field to which it had never been applied before but which had been exposed to a pesticide from the same chemical group; this phenomenon is known as cross-adaptation.

Phylogenetic analysis of 16S rRNA gene sequence of P. aeruginosa strain PA showed that this strain PA was closely related to P. aeruginosa strain YL 84 (a chitinase-producing quorum-sensing bacterium) (Chan et al., 2014) and P. aeruginosa strain Pa 24 isolated from Areca nut garden soil and showed herbicide biodegradation ability. The present study results were confirmed by Singh (2009) who reported that the bacteria with the capacity to degrade OPCs were more closely related than those without degrading capability. Phylogenetic analysis of 16S rRNA gene sequence of P. mendocina strain PM showed that it was the closest to fomesafen-degrading P. mendocina strain FB5. The phylogenetic tree showed sister linage between sequences of xenobiotic degrading microorganisms. The same results were obtained by Cabrera et al. (2010) who reported that fenamiphos degrading bacteria were more closely related than others, and suggested that nematicide degrading bacteria were grouped within a common microbial population which can be of great significance for the soil ecology.

The two bacterial strains isolated in this study were able to utilize MAL as a sole carbon and energy source. In this study of MAL biodegradation, in the presence of yeast extract, glucose or citrate as additional carbon sources, there was a marked increase in the bacterial biomasses for the two bacterial isolates. The findings revealed that P. aeruginosa strain PA and P. mendocina strain PM preferred to utilize MAL even in the presence of rich nutrient environment and its degrading ability was positively influenced by the presence of supplementary nutrient sources. The preferrential use of MAL in the presence of additional carbon sources was attributed to: 1) MAL degrading enzymes in bacteria were expressed even in the presence of readily available carbon sources; 2) The presence of favorite carbon sources accelerate cell growth, reduce the toxicity of MAL and drastically promoted the degradation of pesticides and 3) when a culture medium contained two compounds, the microorganisms preferrentially utilize the most assimilable and the most concentrated until the concentration approached equality, at which time both sources were utilized simultaneously. In the present case, the first sample was taken after 24 h which was considered as a sufficient time for the complete removal of favourable nutrients, at this time, the equillibrium state was reached with high inoculum density. On the other hand, Goda et al. (2010) found that MAL degradation in the presence of other carbon sources was relatively lower than when MAL was present as a sole carbon source for the first 2 days and after 4 days of the degradation was the same in both cases. They explained the preferrential use of favorable carbon sources instead of MAL. Similar findings with this results had been reported for P. putida epII (Karpouzas and Walker, 2000), where the degradation of ethroprophos was inhibited by succinate or glucose. In other studies, the addition of sodium acetate or glucose did not affect the degradation of pentachlorophenol by P.mendocina NSYSU (Kao et al., 2005), neither did supplementation with glucose improved degradation of phenanthrene (Zhao et al., 2009). Thus, inclusion of other carbon sources may or may not affect the biodegradation of the insecticides by bacteria. The gradual consumption of MAL was accompanied by a consistent increase in culture density, which reached maximum once MAL had been completely consumed, suggesting that bacterial growth was driven by MAL catabolism. This result was similar to those reported by Zhao et al. (2009).

The obtained results showed that MAL was degraded by P. aeruginosa strain PA during incubation with the three intial inoculum densities tested (1.5×104, 1.5×108 and 1.5 ×1012 c.f.u.ml-1), while MAL degradation by P.mendocina strain PM in cultures at a concentration of 1.5 ×104 c.f.u.ml-1 could not. Similar results were obtained by Karpouzas and Walker (2000) who found that Sphingomonas strain could not degrade cadusafos when the organism was introduced in soil at a density of 4.3 × 104 cells g−1.

Incubation temperature is an important factor affecting the survival of the organism and degradation of the organophosphorus. Incubation temperature of 30°C could be suggested to be the optimum for the growth of the organism and production of degrading enzymes of P.aeruginosa and P. mendocina giving higher extent of MAL degradation by these isolates. Studies by Hong and colleagues (2007) reported that Pseudomonas sp. and Burkholderia sp. were able to degrade fenitrothion over a temperature range of 20-40°C with optimum degradation at 30°C. Yang et al. (2008) showed that 30°C is the optimal temperature for heterologous expression of methyl parathion hydrolase enzyme (MPH). They found that 30°C is optimal for the formation of properly folded enzyme and inhibition of ATP-dependent and ATP-independent proteolysis. Also, Kaneva and co-workers (1998) found that cultures expressing organophosphate hydrolase enzyme (OPH) constitutively on the surface did not survive at 37°C and could only be grown at 30°C or lower temperatures.

In the present study, analysis of MAL bacterial culture by HPLC/MS was carried out to identify the metabolite(s) produced due to MAL degradation. It was found that the spectrum pattern of the separated products showed molecular ion peaks, suggesting that the primary degradative pathway of MAL might be due to the activity of esterase enzyme (Goda et al., 2010). From HPLC/MS analysis for identification of the metabolites produced from MAL degradation, it was concluded that carboxy-lesterase enzyme might be the enzyme responsible for the degradation of MAL.

Sequence analysis in the present study of carboxylesterases enzymes of P. aeruginosa strain showed a high similarity with carboxylesterase enzyme of P. aeruginosa. However, there was no homology with the previously described carboxylesterase enzyme or with other recognized hydrolases that were isolated from mammals or microorganisms. The finding suggested that carboxylesterase in P. aeruginosa strain is a novel esterase enzymes that differed from those previously mentioned.

This study carboxylesterase enzyme maybe coded by chromosomal genes, suggesting that it should be a stable trait, once more emphasizing the potential for use of these isolates in bioremediation process. The suggestion was almost confirmed by the stability of its degradation power even in the presence of other favorable carbon sources. A recent study by Farrugia et al. (2013) confirmed the result that carboxylesterase enzyme was encoded by chromosomal genes. On the other hand, many of the genes for xenobiotic transformation were carried on mobile elements such as plasmids (Pieper and Reineke, 2000) or megaplasmid of 60 Kb in Bacillus sp. (Niazi et al., 2001).

For future work, there is a need for further research on some other parameters that may affect the degradation of organophosphorus compounds such as pH and use of different concentrations of the same organic substrate. As shown, these bacterial enivronmental biohazards to carboxylesterase enzyme purification and stability is one of the aims of future research and attempt of enzyme cloning in a competent Escherichia coli will also be the authors' concern.


 CONFLICT OF INTERESTS

The authors have not declared any conflict of interests.



 REFERENCES

Anwar S, Liaquat F, Khan QM, Khalid ZM, Iqbal S (2009). Biodegradation of chlorpyrifos and its hydrolysis product 3,5,6-trichloro-2-pyridinol by Bacillus pumilus strain C2A1. J. Hazard Mater. 168:400-405.
Crossref

 

Cabrera JA, Kurtz A., Sikora RA,Schouten A (2010). Isolation and characterization of fenamiphos degrading bacteria. Biodegradation 21:1017-1027.
Crossref

 
 

Chan K -G K, Yin WW-F,Lim YLY (2014). Complete genome sequence of Pseudomonas aeruginosa strain YL84, a quorum-sensing strain isolated from compost. Genome Announce. 2:9-10.
Crossref

 
 

Chong TM, Yin W-F, Mondy S, Grandclément C, Dessaux Y, Chan K-G (2012). Heavy-Metal Resistance of a France Vineyard Soil Bacterium, Pseudomonas mendocina Strain S5.2, Revealed by Whole-Genome Sequencing. J. Bacteriol. 194(22):6366-6366.
Crossref

 
 

Eddleston M, Buckley NA, Eyer P,Dawson AH (2008). Management of acute organophosphorus pesticide poisoning. Lancet 371:597-607.
Crossref

 
 

Farrugia DN, Elbourne LDH, Hassan KA, Eijkelkamp BA, Tetu SG, Brown M.H, Shah BS, Peleg AY, Mabbutt BC,other authors (2013). The complete genome and phenome of a community-acquired Acinetobacter baumannii. PLoS One. 8:e58628.
Crossref

 
 

Gasteiger E, Gattiker A, Hoogland C, Ivanyi I, Ron D (2003). ExPASy: the proteomics server for in-depth protein knowledge and analysis. Nucleic Acids Res. 31(13):3784-3788.
Crossref

 
 

Goda SK, Elsayed IE, Khodair TA, El-Sayed W, Mohamed ME (2010). Screening for and isolation and identification of malathion-degrading bacteria: cloning and sequencing a gene that potentially encodes the malathion-degrading enzyme, carboxylestrase in soil bacteria. Biodegradation 21:903-913.
Crossref

 
 

Hong Q, Zhang Z,Hong Y, Li, S (2007). A microcosm study on bioremediation of fenitrothion-contaminated soil using Burkholderia sp. FDS-1. Int. Biodeterior. Biodegrad. 59:55-61.
Crossref

 
 

Hosokawa M, Furihata T, Yaginuma Y, Yamamoto N, Koyano N, Fujii A, Nagahara Y, Satoh T, Chiba K (2007). Genomic structure and transcriptional regulation of the rat, mouse, and human carboxylesterase genes. Drug Metab. Rev. 39:1-15.
Crossref

 
 

Janeczko AK, Walters EB, Schuldt SJ, Magnuson ML, Willison SA, Brown LM, Ruiz ON, Felker DL, Racz L (2014). Fate of malathion and a phosphonic acid in activated sludge with varying solids retention times. Water Res. 57:127-39.
Crossref

 
 

Jeukens J, Boyle B, Kukavica-Ibrulj I, Ouellet MM, Aaron SD, et al. (2014) Comparative Genomics of Isolates of a Pseudomonas aeruginosa Epidemic Strain Associated with Chronic Lung Infections of Cystic Fibrosis Patients. PLoS ONE 9(2):e87611.
Crossref

 
 

Kaneva I, Mulchandani A, Chen W (1998). Factors influencing parathion degradation by recombinant Escherichia coli with surface-expressed organophosphorus hydrolase. Biotechnol. Prog. 14:275-278.
Crossref

 
 

Kao CM, Liu JK, Chen YL, Chai CT, Chen SC (2005). Factors affecting the biodegradation of PCP by Pseudomonas mendocina NSYSU. J. Hazard. Mater. 124:68-73.
Crossref

 
 

Karalliedde L,Senanayake N (1988). Acute organophosphorus insecticide poisoning in Seri Lanka. Forensic Sci. Int. 36:97-100.
Crossref

 
 

Karpouzas DG, Walker A (2000). Aspects of the enhanced biodegradation and metabolism of ethoprophos in soil. Pest. Manag. Sci. 56:540-548.
Crossref

 
 

Kimura M (1980). "A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences". J. Mol. Evol. 16(2):111-120.
Crossref

 
 

Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG (2007). Clustal W and Clustal X version 2.0. Bioinformatics. 23(21):2947-2948.
Crossref

 
 

Li Q, Chen R, Li W, Qiao CL,Wu Y-J (2007). A genetically engineered Escherichia coli, expressing the fusion protein of green fluorescent protein and carboxylesterase B1, can be easily detected in the environment following degradation of pesticide residues. Biotechnol. Lett. 29:1357-1362.
Crossref

 
 

Mulbry WW, Del Valle PL,Karns JS (1996). Biodegradation of the organophosphate insecticide coumaphos in highly contaminated soils and in liquid wastes. Pestic. Sci. 48:149-155.
Crossref

 
 

Niazi JH, Prasad DT,Karegoudar TB (2001). Initial degradation of dimethylphthalate by esterases from Bacillus species. FEMS Microbiol. Lett. 196: 201-205.
Crossref

 
 

Pieper DH,Reineke W (2000). Engineering bacteria for bioremediation. Curr. Opin. Biotechnol. 11: 262-270
Crossref

 
 

Prakash D, Chauhan A, Jain RK (1996). Plasmid-encoded degradation of p-nitrophenol by Pseudomonas cepacia. Biochem. Biophys. Res. Commun. 224:375-381.
Crossref

 
 

Ragnarsdottir KV (2000). Environmental fate and toxicology of organophosphate pesticides J. Geol. Soc.157:859-876
Crossref

 
 

Ranola JMO, Ahn S, Sehl M, Smith DJ, Lange K (2010). A Poisson model for random multigraphs. Bioinformatics 26(16):2004-2011.
Crossref

 
 

Saitou N, Nei M (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4(4):406-25.

 
 

Singh BK (2009). Organophosphorus-degrading bacteria: ecology and industrial applications. Nat. Rev. Microbiol. 7:156-164.
Crossref

 
 

Singh B, Kaur J, Singh K. (2012). Biodegradation of malathion by Brevibacillus sp. strain KB2 and Bacillus cereus strain PU. World J. Microbiol . Biotechnol. 28(3):1133-1141.
Crossref

 
 

Singh BK, Walker A, Morgan JAW, Wright DJ (2004). Biodegradation of chlorpyrifos by Enterobacter strain B-14 and its use in bioremediation of contaminated soils. Appl. Environ. Microbiol. 70:4855-4863.
Crossref

 
 

Sogorb MA, Vilanova E & Carrera V (2004). Future application of phosphotriesterases in the prophylaxis and treatment of organophosphorus insecticide and nerve agent poisoning. Toxicol. Lett. 151:219-233.
Crossref

 
 

Tamura K, Stecher G, Peterson D, Filipski A, Kumar S.(2013). MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol. Biol. Evol. 30(12):2725-2729.
Crossref

 
 

Yang J, Yang C, Jiang H,Qiao C (2008). Overexpression of methyl parathion hydrolase and its application in detoxification of organophosphates. Biodegradation 19:831-839.
Crossref

 
 

Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL (2012). Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics 13:134
Crossref

 
 

Zhao H-P, Wu Q-S, Wang L, Zhao X-T, Gao H-W (2009). Degradation of phenanthrene by bacterial strain isolated from soil in oil refinery fields in Shanghai China. J. Hazard Mater. 164:863-869.
Crossref

 

 




          */?>