Full Length Research Paper
Abstract
The 5’ region of the sucrose-phosphate synthase gene (sps1) of the Indica riceconsists of an atypical promoter which lacks TATA box but has a putative initiator sequence overriding a second transcription initiation site. Analysis of the transient expression of truncated versions of the sps1 promoter (from -148 to +21) fused to the uidA reporter gene was performed. The results showed that a stretch of 22 bp (GTGTCACCCGCCAGCCTCCCT), from -1 to +21, is sufficient to confer basal transcription activity. These data suggest that an initiator-like sequence (TCACCC) is the responsible of this basal activity.
Key words: Core promoter, sps1 gene, expression analysis.
Copyright © 2024 Author(s) retain the copyright of this article.
This article is published under the terms of the Creative Commons Attribution License 4.0