African Journal of
Microbiology Research

  • Abbreviation: Afr. J. Microbiol. Res.
  • Language: English
  • ISSN: 1996-0808
  • DOI: 10.5897/AJMR
  • Start Year: 2007
  • Published Articles: 5233

Full Length Research Paper

Isolation and characterization of petroleum product emulsifying Pseudomonas strains from a generating set fuel tank

Lebonguy A. A.
  • Lebonguy A. A.
  • URR Microbiologie, Institut de Recherche en Sciences Exactes et Naturelles, BP 1286, Pointe-Noire, Congo.
  • Search for this author on:
  • Google Scholar
Goma-Tchimbakala J.
  • Goma-Tchimbakala J.
  • URR Microbiologie, Institut de Recherche en Sciences Exactes et Naturelles, BP 1286, Pointe-Noire, Congo.
  • Search for this author on:
  • Google Scholar
Miambi E.
  • Miambi E.
  • Faculté des Sciences, Université Paris Est Créteil (UPEC) - Institut d'Ecologie et des Sciences de l'Environnement de Paris (iEES), 61 Avenue du Général de Gaulle, 94010 Créteil Cedex France.
  • Search for this author on:
  • Google Scholar
Keleke S.
  • Keleke S.
  • URR Microbiologie, Institut de Recherche en Sciences Exactes et Naturelles, BP 1286, Pointe-Noire, Congo.
  • Search for this author on:
  • Google Scholar


  •  Received: 06 May 2016
  •  Accepted: 11 October 2016
  •  Published: 14 June 2017

 ABSTRACT

This study characterized microbial strains isolated from diesel fuel samples collected from the tank of a generating set at the Institute of Research for Development in Pointe-Noire (Congo). Two bacterial isolates (G2 and G3) were distinguished by their color on agar plates and were characterized by their API 20E biochemical profiles and by 16S rRNA gene sequencing. The phenotypic properties of these isolates were consistent with their assignment to the genus Pseudomonas. Comparative 16S rRNA gene sequence analysis demonstrated that the G2 and G3 isolates were close relatives of P. aeruginosa strain GIM 32 and P. aeruginosa strain NV2, respectively, with 97% sequence identity. These two P. aeruginosa strains were able to grow in a mineral salt medium supplemented with 2% diesel fuel or SAE 90 gear oil as the only source of carbon. P. aeruginosa G3 showed faster growth and was able to emulsify diesel fuel (53%), gasoline (90%) and hexane (95%) more strongly than P. aeruginosa G2.

 

Key words: Pseudomonas, emulsification index, diesel fuel, gasoline, hexane.


 INTRODUCTION

Oil spills are of increasing environmental concern, including physical damage that has a direct impact on wildlife and habitats. They affect a wide range of organisms that are linked in a food chain that includes human food resources (Pennings et al., 2014; Silliman et al., 2012). Traditional measures such as containment using floating devices so that the oil can be recovered or absorption  by   natural   or   synthetic   materials,  do  not include breaking down the petroleum products (Pirôllo et al., 2008). Therefore, the use of biological surface-active compounds such as biosurfactants is promising owing to their biodegradability, low toxicity and effectiveness in increasing the biodegradability of low solubility organic compounds (Desai and Banat, 1997; Khire, 2010).
 
Biosurfactants are amphiphilic compounds with both hydrophobic   and   hydrophilic   moieties that partition preferentially at the interfaces between non-polar and polar fluids, such as oil/water and air/water (Desai and Banat, 1997). These properties enable biosurfactants to reduce surface and interfacial tension and thus increase the surface area of the immiscible phases, increasing mobility, bioavailability and subsequent biodegradation (Leahy and Colwell, 1990). Biosurfactants are produced by a large number of microorganisms which utilize a wide range of carbon sources, including oil, resulting in the breakdown of the pollutants into low molecular weight compounds (Banat et al., 2000, 2014; Abdel-mawgoud et al., 2010). The breakdown and solubilization of hydro-carbons form an important stage in the bioremediation of oil spills. Hydrocarbon-degrading microorganisms produce biosurfactants, with a wide range of chemical compounds and molecular weights that increase the surface area of the hydrophobic substrates and their bioavailability, thereby increasing bacterial growth and the bio-remediation rate (Ron and Rosenberg, 2002).
 
Microorganisms thriving on oil are found in a wide variety of genera and are able to degrade various types of hydrocarbon, including polycyclic aromatic hydro-carbons (Atlas, 1981; Liang et al., 2014; Dhamodharan and Jayapriya, 2016). Microbial contamination of stored hydrocarbon fuels has been reported in the literature (Gaylarde et al., 1999; Yoshida et al., 2005; Klofutar and Golob, 2007). Much attention has been paid to screening for potential biosurfactant-producing microorganisms in recent years (Desai and Banat, 1997; Dieter et al., 2005). Microorganisms growing on oil usually produce potent emulsifiers. The high emulsification index (E24) is generally a result of the production of a biosurfactant that is able to emulsify the hydrocarbons and render them more accessible for biological breakdown (Perfumo et al., 2006; Qazi et al., 2013). Emulsification is, therefore, one of the criteria used to select potential biosurfactant producers. Most previous screening studies have been carried out on microorganisms isolated from oil-polluted sites.
 
This study set aimed (i) to culture and isolate bacteria in the diesel fuel tank of a generating set, (ii) to characterize the phenotypes and identify the isolates and (iii) to estimate the emulsification index (E24) of the isolates.


 MATERIALS AND METHODS

Sample collection, culture and isolation of bacteria  
 
Diesel oil samples were collected from the tank of an SDMO generating set (Products, Leroy Somer, France) at the Institute of Research for Development (IRD) in Pointe Noire (Congo) and stored at 4°C until use. For the bacterial cultures, 100 µL aliquots of the diesel fuel samples were plated onto a plate count agar (PCA) medium (Fluka, Spain) with 5 g tryptone, 2.5 g yeast extract, 1 g dextrose and 9 g agar per L of distilled water. The pH was adjusted to 7.0±0.1. The cultures were incubated at 37°C for 24 to 96 h under aerobic conditions. Single colonies with a distinct color were isolated by repeated streaking onto  PCA  medium  until  pure.  The isolates were preserved on PCA slants kept at 4°C.
 
Phenotypic characterization of isolates
 
Phenotypic characterization was performed by combining analysis of the morphological traits and the biochemical properties of the isolates. Cell morphology, motility and the presence of spores were assessed using wet mounts with a Paralux optical microscope (L1100 S2 Trino-1600x, France). Gram staining was performed as described in the literature (Gregersen, 1978). Catalase and oxidase tests were performed using standard methods (Seeley et al., 1995; Smibert and Krieg, 1994). The range of growth-permissive temperatures was determined by assessing the growth of isolates on PCA incubated at 25, 37, 44 and 55°C.
 
Biochemical characterization was performed by a set of 20 enterobacteria identification tests using Analytical Profile Index test strips (API 20E, BioMerieux, France) following the manufacturer’s instructions. The twenty microtubes containing dehydrated substrates were inoculated with a bacterial suspension. Each bacterial inoculum was prepared by homogenizing a bacterial colony from the PCA plates in a medium provided with the API 20E strips following the manufacturer’s instructions. The inoculated API 20E strips were incubated at 37°C. During incubation, the microbial metabolism produces color changes that are either immediate or revealed later by the addition of reagents. After incubation, the positive and negative reactions in each strip were interpreted using the Reading Table provided. On the results sheets, the tests were separated into groups of 3 and a value of 1, 2 or 4 was assigned for each positive reaction, in accordance with the manufacturer’s instructions. Adding together the values for a positive reaction for each test within each group gives a 7-digit profile number for the 20 tests in the API 20E strip. The bacteria were identified by referring the profile number in the Analytical Profile Index (p/n 20 190, BioMerieux-France).
 
Identification of strains using 16S rRNA gene sequencing
 
A 1.5 mL subsample of the bacterial culture was transferred to an sterile Eppendorf tube and centrifuged at 10,000g for 10 min. DNA was extracted from the pellets using Fast DNA® SPIN Kit (MP Biomedical, Santa Ana, CA, USA), following the manufacturer’s instructions. Extractions were made in triplicate for each sample. The DNA extracted was quantified using a spectrophotometer (NanoDrop, France). The 16S rRNA gene was amplified by polymerase chain reaction (PCR) in a 25 µL reaction mixture (total volume) using Taq polymerase Ready-To-Go (Amersham Pharmacia Biotech, USA), 0.25 mM of primer 27F (5’AGAGTTTGATCCTGGCTCAG3’), 0.25 mM of primer 1492R (5’GAC GGG CGG TGT GTA CAA-3’) and 20 ng of the template DNA. The PCR was carried out using a thermocycler (VWR, France) with an initial denaturation for 8 min at 94°C; 30 cycles of 30 s at 94°C, 1 min at 56°C and 30 s at 72°C, and a final extension for 15 min at 72°C. The PCR products were run on 1.5% (wt/vol) agarose- 0.5X TAE (Tris, Acetate, EDTA) buffer gel stained with SYBR Safe stain (Invitrogen, France) at 80 V for 30 min and the migration patterns of the PCR products were captured using a GelDoc 2000 transilluminator system (BioRad, Richmond, California, USA). The PCR products were sequenced on both strands using the ABI 3730XL Sanger sequencing platform at the Beckman Coulter Genomics (Essex, United Kingdom). 16S rRNA gene sequences were aligned using Mega 6 and compared with those available in the GenBank database using the gapped sequence BLASTN 2.0.5 program on the National Center for Biotechnology Information server (Altschul et al., 1997). Comparisons were performed using the BLOSUM 62 matrix with default parameters.  Each  sequence  was  aligned  with  the first 10 database sequences giving the highest scores of sequence similarity and the quality of the database sequences was assessed. Bacterial classification and identification were performed at 97% identity of the 16S rRNA gene sequence with that of the closest sequence in GenBank.


 RESULTS

Characterization and identification of isolates
 
The isolates G2 and G3 obtained from culture on PCA supplemented with gas oil as sole carbon source (called in the text isolate G2 and isolate G3) were selected based on the color of their colonies. Isolates G2 and G3 were motile, rod-shaped, Gram-negative, non-spore forming bacteria, with catalase and oxidase activity (Table 1). Growth was observed in cultures incubated at 25 and 37°C but not at 44 and 55°C. 
 
 
Cell growth on diesel-supplemented medium
 
Colonies of both bacterial isolates were transferred into 20 mL nutrient broth (Liofilchen, Italy) and incubated at 30°C for 24 h. Bacterial cells were harvested by centrifugation at 44,000 rpm for 10 min (Eppendorf  5709R centrifuge) and washed three times with 0.85% NaCl. Pellets were then homogenized in 5 mL of 0.85% NaCl and used as an inoculum. Five milliliters of Bushnell Hass (BH) mineral salt broth (Difco, France) consisting of 0.2 g MgSO4, 0.02 g CaCl2, 1.0 g K3PO4, 1.0 g (NH4)2HPO4, 1.0 g KNO3 and 0.05 g FeCl3 per liter  was inoculated with 1% inoculum. The pH was adjusted to pH 7.0 ± 0.2. The medium was supplied with 2% (v/v) autoclaved diesel fuel as the sole source of carbon. The cultures were incubated at room temperature for 20 days and shaken manually every day. Samples were taken every 10 days to determine the cell density. The specific growth rate was calculated using the following formula:
 
µ = lnX – lnX0 / t - t0
 
where, X0 is the initial number of cells; X is the final number of cells; t0 is the initial time; t is the final time.     
 
Emulsification activity assay
 
The isolates were cultivated in Bushnell Haas (BH) broth with  2% v/v  diesel   fuel  for   five  days.  Two  milliliters  of  the culture were poured into a test tube containing 2 mL of petroleum product (diesel fuel or gasoline) or pure hydrocarbon (hexane). After vigorous stirring for 2 min using a standard vortex mixer (VELP Scientifica, Italy), the test tubes were allowed to stand for 24 h at room temperature. The height of the emulsion layer and the total height of the mixture were then measured using a digital slide caliper (DCA150, Velleman, China). The emulsification index (E24 %) was calculated using the standard formula (Ferhat et al., 2011; Gudina et al., 2012):
 
 
Where He is the height of the emulsion and Ht is the total height of the mixture.
 
The reactions of the two isolates to 17 API 20E biochemical   assays   were    negative   while  the assimilation of citrate (CIT) and melibiose (MEL) was positive in both cases (Table 2). For the three remaining biochemical assays, arginine dihydrolase (ADH), gelatinase (GEL) and glucose (GLU) reactions were positive for isolate G2 and negative for isolate G3. Both isolates were identified as members of the genus Pseudomonas by checking the profile number, determined using the Reading Table, in the Analytical Profile Index. The PCR products of targeted 16S rRNA genes were about 1200 bp long. Sequencing of the PCR products and analysis of the distribution of 10 Blast hits on the query sequence resulted in assignments of the isolates G2 and G3 as closest to Pseudomonas aeruginosa strain GIM 32 and P. aeruginosa strain NV2, respectively with 97% sequence identity.
 
 
Growth of the Pseudomonas strains G2 and G3 on BH medium supplemented with either diesel fuel or SAE 90 gear oil as the sole source of carbon
 
Monitoring the cell concentration showed that both Pseudomonas strains G2 and G3 were able to grow on mineral BH medium supplemented with either diesel fuel or SAE 90 gear oil as the sole source of carbon (Figure 1). For the Pseudomonas strain G2 cultured with SAE 90 gear oil, the cell concentration increased to the maximum of 65×107  cells mL-1 over the first 10 day, corresponding to a specific growth rate (µ) of 0.32 d-1, whereas the specific growth rate on diesel fuel was lower at 0.17 d-1. In contrast, for the Pseudomonas strain G3, the growth on SAE 90 gear oil was very slow during the first 10 days of incubation, corresponding to a lag phase while the bacteria adapted to the substrate. After this period, the specific growth rate increased to 0.36 d-1 which was similar to the specific growth rate of Pseudomonas strain G2 under the same culture conditions. The highest specific growth rate of 0.51 d-1 was observed in cultures of Pseudomonas strain G3 supplemented with diesel fuel as the sole source of carbon. No lag phase was observed in cultures of the Pseudomonas strain G3 supplemented with diesel fuel as the sole source of carbon. 
 
 
Emulsification activity of the Pseudomonas strains G2 and G3
 
The Pseudomonas strains G2 and G3 were tested for emulsification activity in diesel fuel, gasoline and hexane (Figure 2). The E24 for the Pseudomonas  strain  G3  was 90% in gasoline and 95% in hexane but only 53% in diesel fuel. The E24 activities for the Pseudomonas strain G2 were 2 to 7 times lower in gasoline/diesel fuel and hexane than those for the strain G3. The strain G2 had no emulsification activity in gasoline/diesel fuel. 
 


 DISCUSSION

Certain microorganisms are better adapted to particular environments, such as oil tanks. This study set out to isolate and determine the phenotypic and molecular characteristics of bacteria in a generating set fuel tank, in particular, their ability to emulsify diesel fuel, gasoline and hexane. The isolates were identified by their API 20E biochemical profiles and by 16S rDNA sequencing since the latter has the highest concordance with conventional methods and is superior to identification by analysis of carbon source utilization (Tang et al., 1998).
 
Although, the isolate G2 was positive for arginine dihydrolase (ADH) and for the assimilation of glucose (GLU) and melibiose (MEL), unlike the isolate G3, the phenotypic and molecular characteristics of the two isolates in this study were consistent with their assignment to the genus Pseudomonas. Comparison of the 16S rRNA gene sequences of isolates G2 and G3 with the GenBank database allowed their assignment to P. aeruginosa strain GIM 32 and P. aeruginosa strain NV2, respectively. These findings are in agreement with previous studies that reported the presence of the strains of P. aeruginosa in hydrocarbon-polluted sites (Widada et al., 2002; Ismail et al., 2015; Das et al., 2014; Coutinho et al., 2013; Sharma et al., 2014) and in stored fuels (Gaylarde et al., 1999; Hamed et al., 2013).
 
The growth of the two Pseudomonas strains isolated in this study was investigated in BH medium which is widely used for the examination of fuels for microbial contamination and for studying hydrocarbon degradation by microorganisms (Silva et al., 2015; Gudiña et al., 2012). Both strains G2 and G3 were able to grow in BH mineral medium with either diesel fuel or SAE 90 gear oil as the sole source of carbon. The increase in cell concentration provides indirect evidence of the utilization of the substrates by the two Pseudomonas strains although the degradation of hydrocarbons was not directly investigated in this study. These observations are in line with previous studies that reported the degradation of gas oil and gear oils by P. aeruginosa strains (Pirôllo et al., 2008; Perfumo et al., 2006; Pacwa-PÅ‚ociniczak et al., 2014; Obayori et al., 2014). It has been demonstrated that bacterial specific growth rates varied with the hydrocarbons or products derived from crude oil (petroleum) used as the source of carbon (Wongsa et al., 2004; Nie et al., 2010; Obayori et al., 2014). Results from the present study indicate that strains belonging to the same genus may show different specific growth rates in culture  media  supplemented  with  the  same  source  of carbon. The isolate G3, for which P. aeruginosa strain NV2 was the closest relative, showed higher specific growth rates than the isolate G2, for which P. aeruginosa GIM 32 was the closest relative, on both 2% SAE 90 gear oil and 2% diesel fuel. These differences may be attributed to the unusually versatile genome of Pseudomonas spp. (Stover et al., 2000). Although, there are clusters of closely related strains whose sequence signatures are conserved in the gene pool (Kiewitz and Tümmler, 2000), the P. aeruginosa genome exhibits great plasticity (Klockgether et al., 2011; Dötsch, 2015; Shen et al., 2006; Liu et al., 2012). The highest cell concentrations in both strains isolated in this study were observed, over the 20 days incubation period, when diesel fuel was used as the sole source of carbon rather than SAE 90 gear oil. This could be explained by the differences in chemical composition between diesel fuel and gear oils. Diesel fuel gas oil is a hydrocarbon mixture with chain lengths of approximately 8 to 21 carbon atoms per molecule obtained by the crude oil distillation whereas gear oils consists of hydrocarbons with chain lengths of between 18 to and 34 carbon atoms per molecule (Collins, 2007). Furthermore, mild extreme pressure (EP) additives for lubricants and functional fluids in gear oils include zinc dialkyldithiophosphate and molybdenum disulfide which may provide metal ions acting as cofactors in essential enzymatic reactions in the P. aeruginosa strain NV2, thus stimulating its growth on SAE 90 gear oil as the sole source of carbon. It has been reported that the emulsification activity of P. aeruginosa is associated with the production of
 
rhamnolipid-type biosurfactants which are among the most effective surfactants known today (Patel and Desai, 1997; Soberon-Chavez et al., 2005; Arutchelvi and Doble, 2010; Marchant and Banat, 2012). Itoh and Suzuky (1972) established a correlation between biosurfactant production and the cell growth of the P. aeruginosa PU-1 mutant strain in water-insoluble substrates. Similar results were also found in the biosurfactant-negative mutant, P. aeruginosa PG-201 (Koch et al., 1997). It is, therefore, likely that biosurfactants were produced by the two Pseudomonas strains isolated in the present study, as suggested by their ability to emulsify gas oil, gasoline and hexane. Of the two strains isolated in the present study, that closer to P. aeruginosa strain NV2 had a higher emulsification index in gasoline (90%) and hexane (95%) and diesel fuel (53%). This confirms that the emulsification activity depends on the hydrocarbon. Similar observations have been reported by Qazi et al. (2013) who demonstrated that Pseudomonas putida strain SOL-10 had different emulsification activities for a variety of hydrocarbons including n-hexane, N-hexadecane, kerosene, xylene. The differences in emulsification activity in the hydrocarbons tested in this study might be attributed to the production of rhamnolipid congeners which depend on Pseudomonas strains and carbon  substrates  as  shown   by   Bharali  and  Konwar (2011). Rhamnolipid 1 and rhamnolipid 2 are the main glycolipids produced by P. aeruginosa (Desai and Banat, 1997). However, although the emulsification index for P. aeruginosa strain NV2 was of the same order of magnitude as that reported by Das et al. (2014) in diesel fuel, in gasoline and hexane the indices were higher than in previous studies (Gudiña et al., 2012; Rocha et al., 2014). Although, further work will be required to gain a better understanding of the physiology of the strains isolated in this study, the results indicated that the isolate whose closest relative was P. aeruginosa strain NV2 may have great potential for the remediation of sites contaminated by petroleum products.


 CONFLICT OF INTERESTS

The authors did not declare any conflict of interest.



 REFERENCES

Abdel-mawgoud AM, Lépine F, Déziel E (2010). Rhamnolipids : diversity of structures , microbial origins and roles. Appl. Microbiol. Biotechnol. 86:1323-1336
Crossref
 

Altschul XF, Stephan J, Thomas L, Madden X, Alejandro A, Schäffer X, Zhang J, Zhang Z, Miller W, Lipman DJ (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3382-3402.
Crossref

  
 

Arutchelvi J, Doble M (2010). Characterization of glycolipid biosurfactant from Pseudomonas aeruginosa CPCL isolated from petroleum-contaminated soil. Lett. Appl. Microbiol. 51:75-82.
Crossref

  
 

Atlas RM (1981). Microbial degradation of petroleum hydrocarbons: an environmental perspective. Microbiol. Rev. 45(1):180-208.

  
 

Banat IM, Makkar RS, Comeotra SS (2000). Potential commercial applications of microbial surfactants. Appl. Microbiol. Biotechnol. 53: 495-508.
Crossref

  
 

Banat IM, Satpute SK, Cameotra SS, Patil R, Nyayanit NV (2014). Cost effective technologies and renewable substrates for biosurfactants' production. Front. Microbiol. 5(697):1-18.

  
 

Bharali P, Konwar BK (2011). Production and physico-chemical characterization of a biosurfactant produced by Pseudomonas aeruginosa OBP1 isolated from petroleum sludge. Appl.Biochem.Biotechnol. 164 :1444-1460.
Crossref

  
 

Collins Chris (2007). Implementing Phytoremediation of Petroleum Hydrocarbons, Methods in Biotechnology. Humana Pre. Vol. 23.

  
 

Coutinho JOPA, Silva MPS, Moraes PM, Monteiro AS, Barcelos JCC, Siqueira EP, Santos VL (2013). Bioresource technology demulsifying properties of extracellular products and cells of Pseudomonas aeruginosa MSJ isolated from petroleum-contaminated soil. Bioresour. Technol. 128:646-54.
Crossref

  
 

Das P, Yang X-P, Ma LZ (2014). Analysis of biosurfactants from industrially viable Pseudomonas strain isolated from crude oil suggests how rhamnolipids congeners affect emulsification property and antimicrobial activity. Front. in Microbiol. 5(696):1-8.
Crossref

  
 

Desai DJ, Banat IM (1997). Microbial Production of Surfactants and Their Commercial Potential. Microbiol. Mol. Biol. Rev. 61:47-64.

  
 

Dhamodharan D, Jayapriya J (2016). Integrated approach for polycyclic aromatic hydrocarbon solubilization from the soil matrix to enhance bioremediation integrated approach for polycyclic aromatic hydrocarbon solubilization from the soil matrix to enhance bioremediation. Bioremed. J. 19(4):287-295.
Crossref

  
 

Dieter H, Rolf H, Reiner C, Kleber H-P (2005). Extracellular microbial lipids as biosurfactants. In cheper W, Belkin Th, Bley S, Bohlmann Th, Doran J, Gu PM, Hu MB, Mattiasson WS, Nielsen B, Seitz J, Ulber H, Zeng R, Zhong AP, Zhou JJ, ed. Advances in Biochemical Engineering/Biotechnology. Springer Berlin Heidelberg pp. 53-93.

  
 

Dötsch A, Schniederjans M, Khaledi A, Hornischer K, Schulz S, Bielecka A, Eckweiler D, Pohl S, Häussler S (2015). The Pseudomonas aeruginosa transcriptional landscape is shaped by environmental heterogeneity and genetic variation. mBio 6(4):e00749-15.
Crossref

  
 

Ferhat S, Mnif S, Badis A, Eddouaouda K, Alouaoui R, Boucherit A, Mhiri N, Moulai-Mostefa N, Sayadi S (2011). Screening and preliminary characterization of biosurfactants produced by Ochrobactrum Sp. 1C and Brevibacterium Sp. 7G isolated from hydrocarbon-contaminated soils. Int. Biodeter. Bioremed. 65:1182-88.
Crossref

  
 

Gaylarde CC, Bento FM, Kelley J (1999). Microbial contamiantion of stored hydrocarbon fuels and its control. Rev. de Microbiol. 30:1-10.
Crossref

  
 

Gregersen T (1978). Rapid method for distinction of gram-negative from gram-positive bacteria. European J. Appl. Microbiol. Biotechnol. 5:123-127.
Crossref

  
 

Gudina Ej, Pereira JFB, Rodrigues L, Coutinho JAP, Teixeira JA (2012). Isolation and study of microorganisms from oil samples for application in microbial enhanced oil recovery. Int. Biodeter. Bioremed. 68:56-64.
Crossref

  
 

Hamed SB, Gam ZBA, Rezgui R, Ghram A, Labat M (2013). Diversity of culturable aerobic bacteria colonizing four petroleum by-products storage reservoirs. Afr. J. Microbiol. Res. 7(21):2542-2549.
Crossref

  
 

Ismail W, Al. Sultanah Shammary, El-sayed WS, Obuekwe C, El Nayal AM, Salam A, Raheem ASA, Al-humam A (2015). Stimulation of rhamnolipid biosurfactants production in Pseudomonas aeruginosa AK6U by organosulfur compounds provided as sulfur sources. Biotechnol. Rep. 7:55-63.
Crossref

  
 

Itoh S, Suzuki T (1972). Effect of rhamnolipids on growth of Pseudomonas aeruginosa Mutant Deficient in n-paraffin-utilizing ability. Agric. Biol. Chem. 36:2233-2235.
Crossref

  
 

Khire JM (2010). Bacterial biosurfactants, and their role in microbial enhanced oil recovery (MEOR). Adv. Exp. Med. Biol. 672:146-57.
Crossref

  
 

Kiewitz C, Tümmler B (2000). Sequence diversity of Pseudomonas aeruginosa: impact on population structure and genome evolution. J. Bacteriol. 182:3125-3135.
Crossref

  
 

Klockgether J, Cramer N, Wiehlmann L, Davenport CF, Tümmler B (2011). Pseudomonas aeruginosa genomic structure and diversity. Front. Microbiol. 2(150):1-18
Crossref

  
 

Klofutar B, Golob J (2007). Microorganisms in diesel and in biodiesel fuels. Acta. Chim. Slov. 54:744-48.

  
 

Leahy JG, Colwell RR (1990). Microbial degradation of hydrocarbons in the environment. Microbiol. Rev. 54(3): 305-315.

  
 

Liang L, Song X, Kong J, Shen C, Huang T, Hu Z (2014). Anaerobic biodegradation of high-molecular-weight polycyclic aromatic hydrocarbons by a facltative anaerobe Pseudomonas Sp. JP1. Biodegr. 25:825-833.
Crossref

  
 

Liu H, Liang R, Tao F, Ma C, Liu Y, Liu X, Liu J (2012). Genome sequence of Pseudomonas aeruginosa strain SJTD-1, a bacterium capable of degrading long-chain alkanes and crude oil. J. bacteriol. 194(17):4783-4784.
Crossref

  
 

Marchant R, Banat IM (2012). Biosurfactants: a sustainable replacement for chemical surfactants? Biotechnol. Lett. 34:1597-1605.
Crossref

  
 

Nie M, Yin X, Ren C, Wang Y, Xu F, Shen Q (2010). Novel rhamnolipid biosurfactants produced by a polycyclic aromatic hydrocarbon-degrading bacterium Pseudomonas aeruginosa strain NY3. Biotechnol. Adv. 28(5):635-643.
Crossref

  
 

Obayori OS, Salam LB, Ogunwumi OS (2014). Biodegradation of fresh and used engine oils by Pseudomonas. Bioremed. Biodegr. 5(1):1-7.

  
 

Pacwa-PÅ‚ociniczak M, PÅ‚aza GA, Poliwoda A, Piotrowska-Seget Z (2014). Characterization of hydrocarbon-degrading and biosurfactant-producing Pseudomonas sp. P-1 strain as a potential tool for bioremediation of petroleum-contaminated soil. Environ. Sci. Pollut. Res. 21:9385-9395.
Crossref

  
 

Patel RM, Desai AJ (1997).Biosurfactant production from Pseudomonas aeruginosa GS3. Lett. Appl. Microbiol. 25:91-94.
Crossref

  
 

Pennings S C, Call BDM, Hooper-Bui L (2014). Effects of oil spills on terrestrial arthropods in coastal wetlands. Bioscience. 64:789-795.
Crossref

  
 

Perfumo A, Banat IM, Canganella F, Marchant R (2006). Rhamnolipid production by a novel thermophilic hydrocarbon-degrading Pseudomonas aeruginosa AP02-1. Appl. Microbiol. Biotechnol. 72: 132-138.
Crossref

  
 

Pirôllo MPS, Mariano AP, Lovaglio RB, Costa SGVAO, Walter V, Hausmann R, Contiero J (2008). Biosurfactant synthesis by Pseudomonas aeruginosa LBI isolated from a hydrocarbon-contaminated site. J. Appl. Microbiol. 105:1484-1490.
Crossref

  
 

Qazi MA, Malik ZA, Qureshi GD, Hameed A, Ahmed S (2013). Yeast extract as the most preferable substrate for optimized biosurfactant production by rhlB gene positive Pseudomonas putida SOL-10 isolat. Bioremed. Biodegr. 4(7):204

  
 

Rocha VMP, Mendes JS, Estela M, Giro A, Melo VMM, Rocha L, Gonçalves B (2014). Biosurfactant production by Pseudomonas aeruginosa MSIC02 in cashew apple juice using a 24 full factorial experimental design. Chem. Ind Chem. Eng. Q. 20(1): 49-58.
Crossref

  
 

Ron, EZ, Rosenberg E (2002). Biosurfactants and oil bioremediation. Curr. Opin. Biotechnol. 13(3): 249-252.
Crossref

  
 

Seeley HW, Vandemark PJ, Lee JJ (1995). Microbes in action, a laboratory manual of microbiology, 4th ed. Freeman WH and Company, New York, NY.

  
 

Sharma A, Kumar P, Rehman M B (2014). Biodegradation of diesel hydrocarbon in soil by bioaugmentation of Pseudomonas aeruginosa: a laboratory scale study. Int. J. Environ. Bioremed. Biodegr. 2(4): 202-212.

  
 

Shen K, Sayeed S, Antalis P, Gladitz J, Ahmed A, Dice B, Janto B, Dopico R, Keefe R, Hayes J, Johnson S, Yu S, Ehrlich N, Jocz J, Kropp L, Wong R, Wadowsky RM, Slifkin M, Preston RA, Erdos G, Post JC, Ehrlich GD, Hu FZ (2006). Extensive genomic plasticity in Pseudomonas aeruginosa revealed by identification and distribution studies of novel genes among clinical isolates. Infect. Immun. 74(9):5272-5283.
Crossref

  
 

Silliman BR, de Koppel JV, McCoy MW, Diller J, Kasozi GN, Earl K, Adams PN Zimmerman AR (2012). Degradation and resilience in louisiana salt marshes after the BP–deepwater horizon oil spill. Proceed. Nat. Acad. Sci.109:11234- 11239.
Crossref

  
 

Smibert RM, Krieg NR (1994). Phenotypic characterization. In: Gerhardt P, Murray RG, Wood WA, Krieg NR (eds), Methods for General Mol. Bacteriol. 5:611-654. American Society for Microbiology, Washington DC.

  
 

Soberon-Chavez G, Lépine F, Déziel E (2005). Production of rhamnolipids by Pseudomonas aeruginosa. Appl. Microbiol. Biotechnol. 68:718-725.
Crossref

  
 

De Souza Pereira Silva D, De Lima Cavalcanti D, De Melo JVE, Dos Santos PNF, Da Luz ELP, De Gusmão M, De Fatima Vieira de Queiroz Sousa NB (2015). Bio-removal of diesel oil through a microbial consortium isolated from a polluted environment. Int. Biodeter. Biodegr. 97:85-89.
Crossref

  
 

Stover CK, Pham XQ, Erwin A L, Mizoguchi SD, Warrener P, Hickey MJ, Brinkman FS, Hufnagle WO, Kowalik DJ, Lagrou M, Garber RL, Goltry L, Tolentino E, Westbrock-Wadman S, Yuan Y, Brody LL, Coulter SN, Folger KR, Kas A, Lar-big K, Lim R, Smith K, Spencer D, Wong GK, Wu Z, Paulsen IT, Reizer J, Saier MH, Hancock RE, Lory S, Olson MV (2000). Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen. Nat. 406:959-964
Crossref

  
 

Tang YW, Ellis NM, Hopkins MK, Smith DH, Dodge DE, Persing DH (1998). Comparison of phenotypic and denotypic techniques for identification of unusual aerobic pathogenic gram-negative Bacilli. J. Clin. Microbiol. 36(12):3674-3679

  
 

Widada J, Nojiri H, Kasuga K, Yoshida T, Habe H, Omori T (2002). Molecular detection and diversity of polycyclic aromatic hydrocarbon-degrading bacteria isolated from geographically diverse sites. Appl. Microbiol. Biotechnol. 58:202-209.
Crossref

  
 

Wongsa P, Tanaka M, Ueno A, Hasanuzzaman M, Yumoto I, Okuyama H (2004). Isolation and characterization of novel strains of Pseudomonas aeruginosa and Serratia marcescens possessing high efficiency to degrade gasoline, kerosene, diesel oil, and lubricating oil. Curr. Microbiol. 49:415-422.
Crossref

  
 

Yoshida N, Yagi K, Sato D, Watanabe N, Kuroishi T, Nishimoto K, Yanagida A, Katsuragi T, Kanagawa T, Kurane R, Tani Y (2005). Bacterial Communities in Petroleum Oil in Stockpiles. J. Biosci. Bioeng. 99(2):143-149.
Crossref

  

 




Copyright © 2024 Author(s) retain the copyright of this article.

This article is published under the terms of the Creative Commons Attribution License 4.0

Back to Vol. 11 No. 22
Back to articles
SUBSCRIBE TO RSS
SUBMIT MANUSCRIPT
CONFERENCES
          */?>