African Journal of
Bacteriology Research

  • Abbreviation: J. Bacteriol. Res.
  • Language: English
  • ISSN: 2006-9871
  • DOI: 10.5897/JBR
  • Start Year: 2009
  • Published Articles: 123

Full Length Research Paper

Antibiotic resistance genes in diarrheagenic Escherichia coli (DEC) isolated from livestock organic wastes in Ouagadougou, Burkina Faso

Evariste BAKO
  • Evariste BAKO
  • Laboratoire de Biologie Moléculaire d’Epidémiologie et de Surveillance des Bactéries et Virus Transmis par les Aliments (LaBESTA), Centre de Recherche en Sciences Biologiques, Alimentaires et Nutritionnelles (CRSBAN), Université Ouaga I Prof Joseph KI-ZERBO, 03 BP 7021 Ouagadougou 03, Burkina Faso.
  • Search for this author on:
  • Google Scholar
Asseta KAGAMBEGA
  • Asseta KAGAMBEGA
  • Laboratoire de Biologie Moléculaire d’Epidémiologie et de Surveillance des Bactéries et Virus Transmis par les Aliments (LaBESTA), Centre de Recherche en Sciences Biologiques, Alimentaires et Nutritionnelles (CRSBAN), Université Ouaga I Prof Joseph KI-ZERBO, 03 BP 7021 Ouagadougou 03, Burkina Faso.
  • Search for this author on:
  • Google Scholar
Germaine MINOUNGOU
  • Germaine MINOUNGOU
  • Laboratoire National d'Élevage (LNE), Ministère de la Santé animale; 03 BP 7026 Ouagadougou 03 Burkina Faso.
  • Search for this author on:
  • Google Scholar
Noah Obeng NKRUMAH
  • Noah Obeng NKRUMAH
  • Department of Medical Laboratory Sciences, School of Biomedical and Allied Health Sciences, P.O. Box KB 143, Accra, Ghana.
  • Search for this author on:
  • Google Scholar
Tounwendsida Serge BAGRE
  • Tounwendsida Serge BAGRE
  • Laboratoire de Biologie Moléculaire d’Epidémiologie et de Surveillance des Bactéries et Virus Transmis par les Aliments (LaBESTA), Centre de Recherche en Sciences Biologiques, Alimentaires et Nutritionnelles (CRSBAN), Université Ouaga I Prof Joseph KI-ZERBO, 03 BP 7021 Ouagadougou 03, Burkina Faso.
  • Search for this author on:
  • Google Scholar
Cheikna ZONGO
  • Cheikna ZONGO
  • Laboratoire de Biochimie et d’Immunologie Appliquée (LABIA), Centre de Recherche en Sciences Biologiques Alimentaires et Nutritionnelles (CRSBAN), Université Ouaga I Professeur Joseph KI-ZERBO, 03 BP 7131 Ouagadougou 03, Burkina Faso.
  • Search for this author on:
  • Google Scholar
Oumar TRAORÉ
  • Oumar TRAORÉ
  • Laboratoire de Biologie Moléculaire d’Epidémiologie et de Surveillance des Bactéries et Virus Transmis par les Aliments (LaBESTA), Centre de Recherche en Sciences Biologiques, Alimentaires et Nutritionnelles (CRSBAN), Université Ouaga I Prof Joseph KI-ZERBO, 03 BP 7021 Ouagadougou 03, Burkina Faso.
  • Search for this author on:
  • Google Scholar
Réné DEMBÉLÉ
  • Réné DEMBÉLÉ
  • Laboratoire de Biologie Moléculaire d’Epidémiologie et de Surveillance des Bactéries et Virus Transmis par les Aliments (LaBESTA), Centre de Recherche en Sciences Biologiques, Alimentaires et Nutritionnelles (CRSBAN), Université Ouaga I Prof Joseph KI-ZERBO, 03 BP 7021 Ouagadougou 03, Burkina Faso.
  • Search for this author on:
  • Google Scholar
Sidi MOCTAR
  • Sidi MOCTAR
  • Laboratoire National d'Élevage (LNE), Ministère de la Santé animale; 03 BP 7026 Ouagadougou 03 Burkina Faso.
  • Search for this author on:
  • Google Scholar
Anne OUEDRAOGO
  • Anne OUEDRAOGO
  • Laboratoire National d'Élevage (LNE), Ministère de la Santé animale; 03 BP 7026 Ouagadougou 03 Burkina Faso.
  • Search for this author on:
  • Google Scholar
Nicolas BARRO
  • Nicolas BARRO
  • Laboratoire de Biologie Moléculaire d’Epidémiologie et de Surveillance des Bactéries et Virus Transmis par les Aliments (LaBESTA), Centre de Recherche en Sciences Biologiques, Alimentaires et Nutritionnelles (CRSBAN), Université Ouaga I Prof Joseph KI-ZERBO, 03 BP 7021 Ouagadougou 03, Burkina Faso.
  • Search for this author on:
  • Google Scholar


  •  Received: 26 May 2018
  •  Accepted: 15 August 2018
  •  Published: 30 September 2018

 ABSTRACT

Diarrheagenic Escherichia coli (DEC) are often disseminated through the fecal matter of livestock and waste products including slurry and manure. The study aimed to characterize archived DEC recovered from cattle fecal matter, manure and slurry for quinolone resistance and extended spectrum beta-lactamases (ESBLs) with focus on trends in antimicrobial susceptibility patterns. The susceptibility of the bacteria was tested using standard laboratory procedures. Polymerase chain reaction (PCR) was carried out to detect the presence of qnrA, qnrB, qnrS genes and β-lactamase producing genes (blaESBL) such us blaTEM and blaSHV. About 91% of DEC strains were multidrug resistant (MDR) with non-susceptibility to ≥1 agent in ≥3 antimicrobial classes. The most common resistance was to amoxicillin-clavulanic acid (96.36%), followed by tretacycline (89.09%), ceftazidime (76.36%), and cefotaxime (70.780%). qnrS (18.2%) was the most prevalent quinolone resistant genes, followed by qnrB (7.2%) and qnrA (2%). blaTEM (5.45%) was most prevalent than blaSHV genes (3.6%). blaTEM and blaSHV genes were identified in double or multiple-carrying with qnrS and qnrB, no Beta-lactamase (ESBLs) producing strains were observed. This result highlights the importance of livestock fecal matter, manure, and slurries as a significant public health concern and a repository of antibiotic resistant gene.

 

Key words: Diarrheagenic Escherichia coli (DEC), Livestock's fecal matter, manure, slurry, antibiotics resistance, quinolone resistance genes, blaTEM, blaSHV, Burkina Faso.


 INTRODUCTION

Diarrheagenic Escherichia coli (DEC) constitute one of the   most    important    causes    of    gastrointestinal   in developping countries (Okeke, 2009; Bonkoungou et al., 2012; Dembélé et al., 2015;  Konaté  et al., 2017)). Some  common pathotypes of DEC include the Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), (ETEC), and Enteroinvasive E. coli (EIEC) (Okeke, 2009; Sidhu et al., 2013). DEC may account for life-threatening infections and harbor virulence properties such as haemolysins, toxins, effacement factors, and cytotoxic necrotic factors (Kaper et al., 2004).
 
DEC are present in livestock's fecal matter,waste as slurry, manure and are largely contracted through environment (Manyi Loh et al., 2016; Bako et al., 2017). Furthermore, the environment is increasingly being recognized for the role it might play in the global spread of clinically relevant antibiotic resistance (Singer et al., 2016). The nature of this crisis and its health and economic burdens prompt us to identify new alternatives as well as to implement new policies to combat resistance. The emergence of antimicrobial resistance mechanisms, especially those associated with mobile genetic elements, may enhances the possibility that virulence factors genes and antibiotic resistance genes are spread simultaneously, inducing the emergence of new pathogens (Chen et al., 2011; Koczura et al., 2012).
 
The last report of World Health Organization on antibiotics resistance showed that E. coli is commonly resistant to third-generation cephalosporins, including resistance conferred by extended spectrum beta-lactamases (ESBLs), and to quinolones (WHO, 2014).
 
In E. coli, the resistance is primarily associated with the association of mutations in the quinolone-resistance determining regions (QRDRs) of gyrA and parC, which encode topoisomerase II (DNA gyrase) and topoisomerase IV respectively (Hopkins et al., 2005).
 
DEC that harbor blaESBL genes such as the blaTEM and blaSHV ESBL genes (Hoseini et al., 2014; Strau et al., 2015) render ineffective many widely used beta-lactam antibiotics including the third-generation cephalosporin such as cefepime through a secretion of beta-lactamase thereby, limiting available therapeutic options for the treatment of infections caused by these bacteria (Straus et al., 2015).
 
This study aimed to investiguate the quinolone resistant mutations and ESBL genes among DEC isolated in cattle fecal matter, slurries and manure in Ouagadougou, Burkina Faso and and how these mutations correlates with antibiotic susceptibility profiles.


 MATERIALS AND METHODS

Diarrheagenic Escherichia coli (DEC) strain
 
The study involved a total of 55 DEC strains identified from previews study (Bako et al., 2017) (Table 1). E.coli strains have been isolated from  cattle  feces  and  organic  waste  (manure  and slurry) from four livestock markets in the city of Ouagadougou, Burkina Faso between May 2015 and May 2016. A 16-plex Polymerase Chain Reaction (PCR), was used to screen simultaneously the virulence genes specific for Shiga-toxin producing E. coli (STEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Enteroinvasive E. coli (EIEC) and Enteroaggregative E. coli (EAEC) (Müller et al., 2007; Antikainen et al., 2009, Kagambèga et al., 2012). The 16-plex PCR is based on the detection of 15 different pathogroup-specific virulence genes (Table 2). In addition, one E. coli specific gene, uidA, was included. Strains comprised 52 strains of Enterotoxinogene E. coli (ETEC), two strains of Shiga Toxin E. coli (STEC) and one strain of Enteroaggregative E. coli (EAEC).
 
 
 
The antibiotic susceptibility tests
 
Antibiotic susceptibility test was done onto Mueller-Hinton media (Liofilchem, Italy) plate media following the standardized disk diffusion method as described (Bauer et al., 1966) using 16 antibiotic disks. The 16 antibiotics was: amoxicillin clavulanic-acid (AUG, 30 µg), chloramphenicol (C, 30 µg), norfloxacin (NOR, 10 µg), tetracycline (TET, 30 µg), nalidixic-acid (NA, 30 µg), imipenem (IPM, 10 µg), aztreonam (ATM, 30 µg), ceftriaxon (CRO, 30 µg), trimethoprim -sulfate (SXT, 25 µg), ceftazidime (CaZ, 30 µg), nutrofurantoin (F, 300 µg), cefotaxime (CTX, 30 µg), ciprofloxacin (CIP, 5 µg), cephalotin (KF, 30 µg), gentamicin (CN, 10 µg), cefoxitin (FOX, 30 µg).
 
Inhibition diameters of the antibiotics were interpreted according to the European Committee on Antimicrobial Susceptibility Instructions (EUCAST 2015, 2017). The Double Disk Synergy Test (DDST) was used to detect extended-spectrum β-lactamase (ESBL) producing strain according to the european committee on antimicrobial susceptibility testing description. This test is based on the detection of synergy between an amoxicillin clavulanic-acid disc and two discs of third generation cephalosporin’s (ceftriaxone and cefotaxime) separated by 2 to 3 cm. The synergy between the discs, gave the appearance of "champagne cork" shape.
 
Detection of quinolone resistance genes and some ß-lactamase genes
 
DNA extraction
 
DNA was extracted by the thermal shock method. A loopful of bacteria previously cultured on MacConkey sorbitol agar and reisolated on Mueller-Hinton media was transferred to an Eppendorf tube with 250 µL water (nuclease free). The mixture was boiled for 10 min and centrifuged for 1 min at 13000 g. The supernatant was used for in the PCR reactions.
 
Primers and PCR assay
 
Quinolone resistance genes as qnrA, qnrB and qnrS, ß-lactamase gene as blaTEM and blaSHV, were detected by conventional PCR using primers as described by Cattoir et al. (2007). The following primers were used: blaTEM (blaTEM-R: CCAATGCTTATTCAGTGAGG; blaTEM-F: ATGAGTATTCAACATTTCCG),             blaSHV                (blaSHV-R: GATTTGCTGATTTCGCTCGG; blaSHV-F:  TTATCTCCCGTTAAGCCACC), qnrB (QnrB-F: GATCGTGAAAGCCAGAAAGG; QnrB-R:  ACGATGCCTGGTAGTTGTCC), qnrS (QnrS-F: ACGACATTCGTCAACTGCAA; QnrS-R: TAAATTGGCACCCTGTAGGC), qnrA (QnrA-F: TCAGCACAAGAGGATTTCTC; QnrA-R: GGCAGCACTATTACTCCCA).   The    reaction      mixture    (20 µl) contained 4 µl of 5x FIREPol® Master Mix Ready to Load with 7.5 mM MgCl2 (Solis biodyne, Estonia), 1 µl of each primer, and 1 µl of DNA template 14 µl of water (nuclease free). The samples were gently vortexed and the PCR were performed using the thermal cycling condition including the annealing temperatures for each gene. Thermocycling conditions were 94°C for 5 min, following to35 cycles at 94°C for 30s and annealing temperatures were respectively 52°C, 54°C, 57°C, 55°C, 54°C, for blaTEM, blaSHV, qnrB, qnrA, qnrS, and elongation at 72°C for 60 s. The ultimate extension was 72°C for 10 min. The amplicons were visualized by electrophoresis on 1% (weight / volume) gel agarose after migration in the TAE (Tris Acetic acid EDTA) buffer.
 
Statistical analysis
 
SPSS statistics 20 and Microsoft Excel were used for statistical analysis. Bivariate Spearman's rank correlation test was used to determine the association between variables of this study.

 


 RESULTS AND DISCUSSION

The antibiotic susceptibility tests
 
The profile of antibiotics  resistance  revealed  that DEC were resistant to all antibiotics used in this study. The most common resistance (Table 3) was for amoxicillin-clavulanic acid (96.36%) followed by tetracycline (89.09%), ceftazidime (76.36 %) and cefotaxime (70.90%). The resistance rates for ciprofloxacin and norfloxacin (anibiotics belonging to the family of quinolone) were 10.90% and 5.45% respectively. No ESBLs phenotype was reported in this study.
 
The prevalence of resistance to amoxicilin clavulanic acid (84.2%) is comparable to that obtained by Iweriebor et al. (2015) in a similar study conducted on DEC in Cape Town, South Africa.
 
This type of resistance is acquired and could be expressed by a decrease of the activity of the β-lactamase   inhibitor    which    is   clavulanic-acid, resulting from a penicillinase hyperproduction, or the inactivation of the inhibitor itself (Kamga et al., 2014). This fact is considered to be a consequence of selection pressure related to the abuse of these antibiotics (Kamga et al., 2014).
 
The resistance to tetracycline observed in this study is comparable to those obtained in South Africa (96.84%) and Nigeria (64.3%) in diarrheagenic Escherichia coli isolated from effluents from cattle (Ajayi et al., 2011; Iweriebor et al., 2015).
 
 
The resistance to tetracycline is widely disseminated in E. coli, where it is generally mediated by tetracycline efflux pumps, such as tetA (Stavropoulos and Strathdee, 2000; Møller et al., 2016). This high prevalence can be explained by the fact  that  in Burkina, oxytetracycline one of  antibiotic belonging to the tetracycline family is the most antibiotic used in animal health (Samandoulougou et al., 2016).
 
Ceftazidime is third generation cephalosporin antibiotics belonging to the family of β-lactam.
 
The resistance of strains to ceftazidime in this study is comparable to those obtained in South Africa (32%) and Nigeria (50.6%) in Escherichia coli isolated from cattle fecal matter and manure (Iweriebor et al., 2015; Ajayi et al., 2011).
 
The resistance to nalidixic acid, and ciprofloxacin can be explained in general by the fact that fluoroquinolones such as ciprofloxacin and nalidixic acid are less used in dairy cattle than in other species such as poultry (Lanz et al., 2003).
 
91% of DEC strains comprising 47 ETEC, 2 STEC and 1 EAEC isolated from cow fecal matter, sheep fecal matter, goat fecal matter, manure and slurry were multi Drug resistant with non-susceptibility to ≥1 agent in ≥3 antimicrobial classes. Among this multi-drug resistant strain, 2 (ETEC) strains isolated originated from cow fecal matter and sheep fecal matter were resistant to 14 antibiotics of 16 used in this study. No statistic significant correlation was found between the multi drug resistant character of the strains as well as the parameters such as the origin of the strain, the type of DEC. The multi-resistance could be explained by the combination of several resistance mechanisms which in most cases are encoded by molecular supports.
 
No statistic significant correlation was noted with the resistance to de different antibiotic family and the type of DEC pathotype.
 
Carriage of qnrA, qnrB, qnrS, blaTEM and blaSHV genes by DEC
 
This study is the first to focus on the sharing of genes coding for quinolone (qnrA, qnrB, qnrS) and Beta-lactam resistance (blaTEM, blaSHV) by DEC isolated from livestock's fecal matter, manure and slurries in Burkina Faso.
 
The PCR revealed the presence (Table 4) of qnrA, qnrB, qnrS, and blaESBL genes such us blaTEM and blaSHV among DEC. For quinolone gene, qnrS (18.2%) was most prevalent followed by qnrB (7.2%) and qnrA (2%). All qnrS positive strains comprised 14 ETEC from cattle fecal matter, six from slurry and one EAEC from manure. qnrA positive strains comprising three ETEC were isolated from sheep and cow fecal matter. qnrB positive strains comprising 11 ETEC were isolated from cattle fecal matter. Among all qnr gene positives strains, only 9 strains were resistant to antibiotic belonging to the quinolone family such us nalidixic-acid (NA), ciprofloxacin (CIP) and norfloxacin (NOR). Correlation has been found between the susceptibility of DEC to ciprofloxacin and the presence of the qnrA gene (p  =  0.003).  Correlation  was also found between the resistance of DEC to cefoxitin, antibiotic form of cephalosporin class and the presence of qnrS (p = 0.009).
 
 
The prevalence of qnrS and qnrB in this study are comparable to those obtained for qnrS (5.60%) and qnrB (0.43%) from E. coli isolated from farm animal in China (Yue et al., 2008). There are no data concerning the carrying of qnrA gene by DEC isolated from livstock's fecal matter, manure and slurries.
 
In general, the presence of these acquired genes does not confer high level of fluoroquinolones resistance (Rodríguez-Martínez et al., 2011). This could explain the fact that a statistically significant correlation between the susceptibility to the antibiotics belonging to quinolone family was not obtained.
 
Double-carrying qnrB + qnrS (3.6%) and qnrA + qnrS (1.8%) has been also identified among DEC. blaTEM gene (5.45%) was the most prevalent blaESBL genes followed by blaSHV gene (3.6%). blaTEM or blaSHV only positive strain (9.05%) were constituted by five ETEC, three from cattle fecal matter, one from manure and the second one from slurry. All positive blaTEM gene and or the blaSHV gene DEC resisted at least one antibiotic of the ß-lactam class.
 
The prevalance of blaTEM gene is comparable to those obtained in South Africa (27%) and South Korea (17.5%) in DEC (STEC) isolated from dairy cattle farms (Iweriebor et al., 2015; Dong et al., 2017).
 
Multiple carrying (Table 4) of blaESBL genes and quinolo resitance gens were also noted (24.2%) in DEC. These strains were composed to nine ETEC isolated from cattle fecal matter, one ETEC from slurry and one ETEC from manure. These strains were resistant to at least one antibiotic belonging ß-lactam family.
 
No significant statistic correlation was found between susceptibility to Beta-lactamin antibiotics involved in this sudy and the carrying of the blaTEM and blaSHV genes. Double carrying between blaTEM, blaSHV, qnrB and or qnrS gene was observed in 24.2% of the strains in this study. Indeed, qnr genes have been frequently associated with blaESBL genes such as blaTEM and blaSHV genes (Boyd et al., 2004; Woodford and Carattoli, 2009). 


 CONCLUSION

The study showed that there are a lot of multi drug resistant diarrheagenic E. coli which can get to the environment through cattle fecal matter slurry and manure from livestock market located in Ouagadougou, Burkina Faso. This is in line with WHO's observations on the emergence of resistance to beta-lactams, third-generation cephalosporins and quinolones. In fact, these pathogens carry molecular support such us qnrA, qnrB, qnrS, blaTEM and blaSHV. These results show the risk incurred by the population to the exposure of livestock cattle fecal matter and organic waste products of animal origin such as manure and slurries.


 CONFLICT OF INTERESTS

The authors have not declared any conflict of interests.

 


 ACKNOWLEDGEMENT

This work was supported by “Le Laboratoire de Biologie Moléculaire d’Epidémiologie et de surveillance des Bactéries et Virus transmis par les Aliments (LaBESTA); “Laboratoire National d’Elevage, Burkina Faso”, School of Biomedical and allied Health Science, University of Ghana and a Grant of West African Research Association (WARA).



 REFERENCES

Afset JE, Anderssen E, Bruant G, Harel J, Wieler L, Bergh K (2008). Phylogenetic backgrounds and virulence profiles of atypical enteropathogenic Escherichia coli strains from a case-control study using multilocus sequence typing and DNA microarray analysis. Journal of Clinical Microbiology 46:2280-2290.
Crossref
 

Ajayi AO, Oluyege AO, Olowe OA, Famurewa O (2011). Antibiotic resistance among commensal Escherichia coli isolated from feces of cattle in Ado-Ekiti, Nigeria. Journal of Animal and Veterinary Advances 10(2):174-179.
Crossref

  
 

Antikainen J, Tarkka E, Haukka K, Siitonen A, Vaara M, Kirveskari J (2009). New 16-plex PCR method for rapid detection of diarrheagenic Escherichia coli directly from stool samples. European Journal of Clinical Microbiology & Infectious Diseases 28(8):899-908.
Crossref

  
 

Bako E, Kagambèga A, Traore KA, Bagre TS, Ibrahim HB, Bouda SC, Bonkoungou, IJO, Kaboré S, Zongo C, Traore AS, Barro N (2017). Characterization of diarrheagenic Escherichia coli isolated in organic waste products (cattle fecal matter, manure and, slurry) from cattle's markets in Ouagadougou, Burkina Faso. International Journal of Environmental Research and Public Health 14:1100.
Crossref

  
 

Bauer AW, Kirby WMM, Sherries JC, Turck M (1966). Antibiotic susceptibility testing. The American Journal of Pathology 45:493-496.

  
 

Bonkoungou IJO, Lienemann T, Martikainen O, Dembelé R, Sanou I, Traoré AS, Siitonen A, Barro N, Haukka K (2012). Diarrhoeagenic Escherichia coli detected by 16-plex PCR in children with and without diarrhea in Burkina Faso. Clinical Microbiology and Infection 18(9):901-906.
Crossref

  
 

Boyd DA, Tyler S, Christianson S, McGeer A, Muller MP, Willey BM, Bryce E, Gardam M, Nordmann P, Mulvey MR (2004). Complete nucleotide sequence of a 92-kilobase plasmid harboring the CTX-M-15 extended-spectrum beta-lactamase involved in an outbreak in long-term-care facilities in Toronto, Canada. Antimicrobial Agents and Chemotherapy 48(10):3758-3764.
Crossref

  
 

Cattoir V, Poirel L, Rotimi V, Soussy CJ, Nordmann P (2007). Multiplex PCR for detection of plasmid-mediated quinolone resistance qnr genes in ESBL-producing enterobacterial isolates. Journal of Antimicrobial Chemotherapy 60(2):394-397.
Crossref

  
 

Chen B, Zheng W, Yu Y, Huang W, Zheng S, Zhang Y, Guan X, Zhuang Y, Chen N, Topp E (2011). Class 1 integrons, selected virulence genes, and antibiotic resistance in Escherichia coli isolates from the Minjiang River, Fujian Province, China. Applied and Environmental Microbiology 77(1):148-155.
Crossref

  
 

Dembélé R, Bonkoungou IJO, Konaté A, Bsadjo Tchamba G, Bawa HI, Bako E, Bagre TS, Kagambèga A, Zongo C, Traore AS, Barro N (2015). Serotyping and antimicrobial resistance of enteropathogenic Escherichia coli and enterohemorrhagic E. coli O157 isolated from children under five years of age with diarrhea in rural Burkina Faso. African Journal of Microbiology Research 9(14):1053-1059.
Crossref

  
 

Dong HJ, Lee S, Kim W, An JU, Kim J, Kim D, Cho S (2017). Prevalence, virulence potential, and pulsed-field gel electrophoresis profiling of Shiga toxin-producing Escherichia coli strains from cattle. Gut Pathogens 9(1):22.
Crossref

  
 

Hale TL (1991). Genetic basis of virulence in Shigella species. Microbiology Reviews 55:206-224.

  
 

Harrington SM, Dudley EG, Nataro JP (2006). Pathogenesis of enteroaggregative Escherichia coli infection. FEMS Microbiology Letters 254:12-18.
Crossref

  
 

Henderson IR, Czeczulin J, Eslava C, Noriega F, Nataro JP (1999). Characterization of pic, a secreted protease of Shigella flexneri and enteroaggregative Escherichia coli. Infection and Immunity 67:5587-5596.

  
 

Hopkins KL, Davies RH, Threlfall EJ (2005). Mechanisms of quinolone resistance in Escherichia coli and Salmonella: recent developments. International Journal of Antimicrobial Agents 25(5):358-373.
Crossref

  
 

Hoseini SS, Dastmalchi Saei H, Ownagh A (2014). Molecular detection of extended spectrum β-lactamase (ESBL) genes blaCTX-M, blaTEM and blaSHV in Escherichia coli isolated from water buffalo (Bubalus bubalis) feces in West Azerbaijan province. Iranian Journal of Veterinary Research 69(3):203-212.

  
 

Iweriebor BC, Iwu CJ, Obi LC, Nwodo UU, Okoh AI (2015). Multiple antibiotic resistances among Shiga toxin producing Escherichia coli O157 in feces of dairy cattle farms in Eastern Cape of South Africa. BMC Microbiology 15(1):213.
Crossref

  
 

Kagambèga A, Martikainen O, Siitonen A, Traoré AS, Barro N, Haukka K (2012). Prevalence of diarrheagenic Escherichia coli virulence genes in the feces of slaughtered cattle, chickens, and pigs in Burkina Faso. Microbiologyopen 1(3):276-284.
Crossref

  
 

Kamga HG, Nzengang R, Toukam M, Sando Z, Shiro SK (2014). Phénotypes de résistance des souches de Escherichia coli responsables des infections urinaires communautaires dans la ville de Yaoundé (Cameroun). African Journal of Cellular Pathology 3:1-4.
Crossref

  
 

Kaper JB, Nataro JP, Mobley HL (2004). Pathogenic Escherichia coli. Nature Reviews Microbiology 2(2):123-140.
Crossref

  
 

Koczura R, Mokracka J, Jablonska L, Gozdecka E, Kubek M, Kaznowski A (2012). Antimicrobial resistance of integron-harboring Escherichia coli isolates from clinical samples, wastewater treatment plant and river water. Science of the Total Environment 414:680-685.
Crossref

  
 

Konaté A, Dembélé R, Zongo C, Kaboré WAD, Bonkoungou IJO, Traoré AS, Barro N (2017). Occurrence of Multiple Antibiotic Resistances of Escherichia coli Isolated from Diarrheal Children Less Than Five Years in Burkina. European Journal of Pharmaceutical and Medical Research 4(1):165-171.

  
 

Lanz R, Kuhnert P, Boerlin P (2003). Antimicrobial resistance and resistance gene determinants in clinical Escherichia coli from different animal species in Switzerland. Veterinary Microbiology 91(1):73-84.
Crossref

  
 

Manyi-Loh CE, Mamphweli SN, Meyer EL, Makaka G, Simon M, Okoh AI (2016). An Overview of the Control of Bacterial Pathogens in Cattle Manure. International Journal of Environmental Research and Public Health 13(9):843.
Crossref

  
 

Møller TSB, Overgaard M, Nielsen SS, Bortolaia V, Sommer MOA, Guardabassi L, Olsen JE (2016). Relation between tetR and tetA expression in tetracycline resistant Escherichia coli. BMC Microbiology 16(1):39.
Crossref

  
 

Müller D, Greune L, Heusipp G, Karch H, Fruth A, Tschäpe H, Schmidt MA (2007). Identification of unconventional intestinal pathogenic Escherichia coli isolates expressing intermediate virulence factor profiles by using a novel single-step multiplex PCR. Applied and Environmental Microbiology 73(10):3380-3390.
Crossref

  
 

Nataro JP, Kaper JB (1998). Diarrheagenic Escherichia coli. Clinical Microbiology Reviews 11:142-201.

  
 

Nordmann P, Poirel L (2005). Emergence of plasmid-mediated resistance to quinolones in Enterobacteriaceae. Journal of Antimicrobial Chemotherapy 56(3):463-469.
Crossref

  
 

Okeke IN (2009). Diarrheagenic Escherichia coli in sub-Saharan Africa: Status, uncertainties and necessities. Journal of Infection in Developing Countries 3(11):817-842.

  
 

World Health Organization (WHO) (2014). Antimicrobial resistance: global report on surveillance. Who. https://doi.org/1.4.2014

  
 

Pakzad I, Ghafourian S, Taherikalani M, Abtahi H, Rahbar M, Jamshidi N (2011). qnr Prevalence in Extended Spectrum Beta-lactamases (ESBLs) and None-ESBLs Producing Escherichia coli Isolated from Urinary Tract Infections in Central of Iran ESBL screening methods. Iran. Iranian Journal of Basic Medical Sciences14(5):458-464.

  
 

Paton JC, Paton AW (1998). Pathogenesis and diagnosis of Shiga toxin-producing Escherichia coli infections. Clinical Microbiology Reviews 11(3):450-479.

  
 

Rodríguez-Martínez JM, Cano ME, Velasco C, Martínez-Martínez L, Pascual Á (2011). Plasmid-mediated quinolone resistance: An update. Journal of Infection and Chemotherapy 17(2):149-182.
Crossref

  
 

Samandoulougou S, Ilboudo AJ, Ouedraogo GS, Bagre T S, Tapsoba FW, Compaore H, Dao A, Zoungrana A, Savadogo A (2016). Physico-chemical and nutritional quality of eggs from local chicken and of improved race consumed in Ouagadougou, Burkina Faso. International Journal of Biological and Chemical Sciences 10:737–748.
Crossref

  
 

Sidhu JPS, Ahmed W, Hodgers L, Toze S (2013). Occurrence of virulence genes associated with diarrheagenic pathotypes in Escherichia coli isolates from surface water. Applied and Environmental Microbiology 79(1):328-335.
Crossref

  
 

Singer AC, Shaw H, Rhodes V, Hart A (2016) Review of Antimicrobial Resistance in the Environment and Its Relevance to Environmental Regulators. Frontiers in Microbiology 7:1728.
Crossref

  
 

Stavropoulos TA, Strathdee CA (2000). Expression of the tetA(C) tetracycline efflux pump in Escherichia coli confers osmotic sensitivity. FEMS Microbiology Letter 90(1):147-150.
Crossref

  
 

Strau LM, Dahms C, Becker K, Kramer A, Kaase M, Mellmann A (2015). Development and evaluation of a novel universal β-lactamase gene subtyping assay for blaSHV, blaTEM and blaCTX-M using clinical and livestock-associated Escherichia coli. Journal of Antimicrobial Chemotherapy 70(3):710-715.
Crossref

  
 

The European Committee on Antimicrobial Susceptibility Testing (EUCAST) (2015). European Committee on Antimicrobial Susceptibility Testing Breakpoint tables for interpretation of MICs and zone diameters European Committee on Antimicrobial Susceptibility Testing Breakpoint tables for interpretation of MICs and zone diameters. 

View.

  
 

The European Committee on Antimicrobial Susceptibility Testing (EUCAST) (2017). Breakpoint tables for interpretation of MICs and zone diameters, version 7.0, 2017. 0–77. 

View

  
 

Um MM, Barraud O, Kérourédan M, Gaschet M, Stalder T, Oswald E, Dagot C, Ploy MC, Brugère H, Bibbal D (2016). Comparison of the incidence of pathogenic and antibiotic-resistant Escherichia coli strains in adult cattle and veal calf slaughterhouse effluents highlighted different risks for public health. Water Research 88:30-38.
Crossref

  
 

Woodford N, Carattoli AKE (2009). Complete nucleotide sequences of plasmids pEK204, pEK499 and pEK516, encoding CTX-M enzymes in three major Escherichia coli lineages from United Kingdom, all belonging to international 025:H4-ST131 clone. Antimicrobial Agents and Chemotherapy 53:4472-4482.
Crossref

  
 

Yue L, Jiang, HX, Liao XP, Liu JH, Li SJ, Chen XY, Chen CX, Lü DH, Liu YH, Liu, YH (2008). Prevalence of plasmid-mediated quinolone resistance qnr genes in poultry and swine clinical isolates of Escherichia coli. Veterinary Microbiology 132(3-4):414-420.
Crossref

  

 




Copyright © 2025 Author(s) retain the copyright of this article.

This article is published under the terms of the Creative Commons Attribution License 4.0

Back to Vol. 10 No. 4
Back to articles
SUBSCRIBE TO RSS
SUBMIT MANUSCRIPT
CONFERENCES
          */?>