Abstract

Xanthomonas citri subsp. malvacearum (Xcm), the bacterial blight of cotton is the most important bacterial disease on cotton which infects all aerial parts of the host. Loss due to this disease was estimated for about 10 to 30% on Iranian native cultivars. During summer season, cotton leaves samples with typical bacterial blight symptoms were collected from cotton fields of Golestan province in 2004. Among different bacterial isolates, five distinct Xcm isolates were collected for further studies. Besides, 20 partially characterized Xcm strains were obtained from Iranian Plant Protection Organization for comparison purpose. Totally 25 strains were subcultured for further characterization based on morphological, biochemical, pathogenicity traits as well as genetic analyses. Among these, nine strains with distinct phenotypic characteristics were selected for complementary genetic studies. Sodium dodecyl sulphate - polyacrylamide gel electrophoresis (SDS-PAGE) protein analysis did not show any differences among strains in number and size of protein bands. In plasmid analysis, using alkaline lysis method, a single plasmid was detected for all examined isolates with molecular weight of 23 kb. Repetitive sequence based PCR (rep-PCR) fingerprinting assay using primer BOX AIR (5' CTACGGCAAGGCGACGCTGAC 3') also failed to differentiate the Iranian isolates. It was therefore concluded the strains might have the same origin.

Key words: Cotton bacterial blight, protein analysis, plasmid and repetitive sequence based PCR (rep-PCR).