African Journal of
Food Science

  • Abbreviation: Afr. J. Food Sci.
  • Language: English
  • ISSN: 1996-0794
  • DOI: 10.5897/AJFS
  • Start Year: 2007
  • Published Articles: 978

Full Length Research Paper

Staphylococcus aureus and other Staphylococcus species in milk and milk products from Tigray region, Northern Ethiopia

Enquebaher Tarekgne*
  • Enquebaher Tarekgne*
  • Department of Chemistry, Biotechnology and Food Science, Norwegian University of Life Sciences (NMBU), Ã…s, Norway.,College of Veterinary Medicine, Mekelle University, Mekelle, Tigray, Ethiopia.
  • Search for this author on:
  • Google Scholar
Siv Skeie
  • Siv Skeie
  • Department of Chemistry, Biotechnology and Food Science, Norwegian University of Life Sciences (NMBU), Ã…s, Norway.
  • Search for this author on:
  • Google Scholar
Knut Rudi
  • Knut Rudi
  • Department of Chemistry, Biotechnology and Food Science, Norwegian University of Life Sciences (NMBU), Ã…s, Norway.
  • Search for this author on:
  • Google Scholar
Taran Skjerdal
  • Taran Skjerdal
  • National Veterinary Institute (NVI), Oslo, Norway.
  • Search for this author on:
  • Google Scholar
Judith A. Narvhus
  • Judith A. Narvhus
  • Department of Chemistry, Biotechnology and Food Science, Norwegian University of Life Sciences (NMBU), Ã…s, Norway.
  • Search for this author on:
  • Google Scholar


  •  Received: 29 September 2015
  •  Accepted: 02 November 2015
  •  Published: 30 December 2015

 ABSTRACT

Staphylococcus aureus is an important pathogen that can cause Staphylococcal Food Poisoning (SFP). Milk and dairy products are frequently contaminated by this bacterium. In this study, 310 samples (168 bovine raw milk and 142 dairy products) were collected in the Tigray region of Northern Ethiopia, with the objective of detection and enumeration of S. aureus and other Staphylococcus species. Baird-Parker agar for isolation and 16S rRNA gene sequencing for species identification were employed. S. aureus was found in 38.7% of samples with mean count of 4.35 +/- 0.97 log 10 CFU ml -1. The prevalence of S. aureus was significantly greater in raw milk samples (47%) than in dairy products (28.8%). Of all S. aureus positive samples, 34.2% contained >5 log10 CFU ml-1. Samples from cafeterias and restaurants showed the greatest prevalence of S. aureus (P<0.05) compared to other sampling points. Samples from small-scale dairies were twice more likely to be contaminated by S. aureus than traditionally managed dairies (P<0.05, OR=2.0). Coagulase-negative staphylococci (CNS) were found in 51.6% of the samples, with mean count of 6.0±1.21 log10 CFU ml-1. Ten species of CNS were identified and S. epidermidis (36.13%) was the most frequent. The frequency of isolation found in this study indicates that S. aureus and other Staphylococcus spp. may impose public health hazard in dairy products. Therefore, further studies on the enterotoxigenic potential of the isolates, and molecular epidemiology to trace the sources of the contamination are recommended.

 

Key words: Coagulase negative staphylococcus (CNS), dairy products, Ethiopia, Staphylococcus aureus, raw milk.


 INTRODUCTION

Staphylococcal Food Poisoning (SFP) is among the most prevalent  causes  of  gastroenteritis   worldwide. In   the United States, the 2006 Centre for Disease Control (CDC) annual report showed that Staphylococcus aureus enterotoxication was ranked third among bacterial food-borne outbreaks (CDC, 2009), while it was ranked as fourth in Europe (European Food Safety Authority, 2010). In China, a retrospective study (1994 to 2005) revealed that S. aureus was the second most common food-borne agent in homes (Wang et al., 2007). In developing counties like Ethiopia, there is little available data on the incidence of SFP. However, considering the poor hygiene conditions during production & processing of foods, as well as the shortage of cooling facilities, a high occurrence of SFP is likely. S. aureus grows at a wide temperature range between 6 to 48°C with optimum of 35 to 41°C. It tolerates a pH between 4 to 10 with optimum of 6 to 7, a salt concentration of 0 to 20%, and a water activity (aw ) level of 0.83 to 0.99 with optimum at 0.99 (Cretenet et al., 2011).
 
These growth characteristics enable the bacterium to grow in a wide range of foodstuffs including milk and dairy products (Loir et al., 2003; Meyrand et al., 1998). Although, S. aureus is ubiquitous in nature, humans and animals are the primary reservoirs. Around 50% of healthy individuals harbour the bacteria in their nasal passage, throat and skin (Bergdoll and Wong, 2006; Hennekinne et al., 2011) whereas the mastitic cow is a common source of S. aureus in raw milk (Kadariya et al., 2014; Loir et al., 2003). S. aureus has many potential virulence factors and staphylococcus enterotoxin (SE) is one of among several responsible for food poisoning. Ingestion of less than 1.0 µg enterotoxin causes SFP (Seo and Bohach, 2007). To date, 21 SE and SEI (Staphylococcus Enterotoxin Like: SE that lack emetic properties) have been identified and designated as SEA-SEE (classical), SEG-SEI (new), SEIJ-SEIV (new) (Argudin et al., 2010; Bennett and Hait, 2011; Hennekinne et al., 2011; Ortega et al., 2010). Recent research reported that among S. aureus food isolates, 57% up to 72.8% harbour the classical and/or new SE genes (Akineden et al., 2001; Rosec and Gigaud, 2002).
 
The milk production systems in Ethiopia are classified into rural/traditional, peri-urban and urban production systems (Redda, 2001). The traditional/rural dairy represents the milk production in the mixed and pastoral/agro-pastoral farming systems and accounts for 97% of the total national production. The majority of the milking cows here are the indigenous zebu breed. The urban and peri-urban production systems include small and large scale dairy farms with a commercially oriented purpose and use exotic cross breed animals (Ahmed et al., 2003). Like all parts of Africa, traditional milk processing is a common practice in Ethiopia. The naturally sour/fermented milk (Rego) and buttermilk (Auso) are made from raw bulked milk. Butter and Ethiopian cottage cheese (Ajibo) are made by churning of soured milk and heating of sour buttermilk, respectively. The  traditional  milk  preparation   activities   have   been shown to be unhygienic and consequently expose  to microbial contamination (Yilma et al., 2007).
 
Due to favourable agricultural policy and gradual improvement in living standards of the population, there is an on-going expansion of small-scale dairy farmers around the major cities of Ethiopia. The country showed 3 % increase in annual milk production in the past decade compared to 1.63-1.66 % of the previous two decades. This trend is also predicted to continue as there is great livestock potential and a suitable climatic environment for dairying (Ahmed et al., 2004).
 
However, if milk safety and quality standards are not in place, the high nutritional composition and neutral pH of milk may convey many food-borne pathogens and thereby constitute a public health challenge to consumers (Angulo et al., 2009). In the country clinical and subclinical mastitis mainly caused by S. aureus are a major challenge in the majority of Ethiopian dairy farms (Abera et al., 2010; 2009; Sori, 2011), moreover, a recent survey conducted in central Ethiopia also reported that 31.8% of farmers consume raw milk (Makita et al., 2012) that increased the risk of milk borne contaminations.
 
Therefore, in order to protect consumers from microbial hazards it is of paramount importance to study and monitor the type and level of pathogenic microbes such as S. aureus in the milk value chain. Such surveillance data may provide a basis for risk assessment study as well as give a foundation for the establishment of national milk quality standards that currently do not exist in Ethiopia. In light of this, there is a knowledge gap concerning the occurrence and distribution of S. aureus and other Staphylococcus species in the milk value chain in the Northern part of Ethiopia. The present study has therefore been designed to fill this gap.


 MATERIALS AND METHODS

 
 
Study design and sampling points
 
A cross sectional study was conducted from August, 2012 to January, 2013. Samples were collected randomly from small-scale dairy farms, traditionally managed dairies at household level, milk collection centres/cooperatives, milk and milk product shops, market places and cafeteria and restaurants. A free informed consent was obtained from the milk and milk product owners, after explaining the research purpose, potential benefits, risks if any, and confidentiality of the research project.
 
Sampled milk and products
 
A total of 310 samples (168 bovine raw bulk milk and 142 milk product) were collected. These were: raw bovine bulk milk (n= 168), naturally soured/fermented raw milk (n=51), butter milk (n=44), butter (n= 32), Ethiopian cottage cheese (n=7), Cheese (n= 4) and Cake made from milk (n=4).
 
Sampling methodology
 
From each sampling unit, 100 ml of mixed raw bulk milk or 100 g of
milk product was collected in a sterile container and maintained at  4°C.
 
Microbial analysis
 
Milk and milk products
 
From the raw milk samples, tenfold serial dilutions were made. While for the milk products, 11 g of the product was mixed with 99 ml peptone water (Sigma-Aldrich, Switzerland) and blended for 2 min in a stomacher (Stomacher® 400, UK) before further dilutions. The isolation and enumeration of S. aureus were performed as per Ahmed and Carolyn (2003) with some modifications. Briefly, 100 µl of each tenfold dilution of the samples was spread with a sterile bent glass rod into duplicate Baird-Parker agar (Oxoid, England) supplemented with egg yolk tellurite (Merck, Germany). Typical and non-typical colonies were differentially counted after incubation of the plates at 37°C for 48 h. Circular colonies of 2 to 3 mm diameter, jet-black to gray-black in colour and surrounded by an opaque halo and clear zone were considered as a typical S. aureus colonies while gray colonies without halos or clear zones were considered as non-typical.
 
Both typical and non typical colonies were gram-stained and tested for catalase activity (3% H2O2, VWR/International). Moreover, to ensure the purity of the colony before further biochemical tests, 3 to 4 colonies from each type of colony were sub-cultured into Brain Heart Infusion (BHI) broth (Oxoid, England) and incubated overnight at 37°C. From the overnight culture, the following tests were performed as per Benntt and Lancette (2001) recommendations: tube coagulase test on rabbit plasma with EDTA (Remel, Lenexa, KS, USA); DNase test on agar with toluidine blue (Sigma-Aldrich, USA), and anaerobic fermentation of 1% mannitol (Sigma-Aldrich, USA).
 
Pure cultures were preserved with 85% glycerol in cryovials (Sarstedt, Nümbrecht, Germany) and stored at – 20°C until they were transported to Norwegian University of Life Sciences (NMBU), Norway for further molecular work. At NMBU, they were stored at -80 until analysis.
 
Genetic identification
 
The isolates of Staphylococcus species were cultured on Baird Parker agar, supplemented with egg yolk tellurite, followed by sub-culturing of a single colony in BHI to obtain a pure culture.
 
DNA extraction
 
From the over-night BHI culture, DNA was extracted by GenElute TM Bacterial Genomic DNA Kit (Sigma-Aldrich, USA) as per the manufacturer’s instructions with some minor modifications. In summary, 1 ml of the broth was centrifuged at 16 363 x g for 2 min. The pellet was washed twice with 0.9% aqueous NaCI solution, homogenized with 200 µl of lysosome solution and incubated at 37°C for 90 min. The suspension was treated with 20 µl each of RNase and proteinase K, followed by 200 µl of lysis solution C, and incubated at 55°C for 60 min. The lysate was treated with 200 µl of ethanol and transferred into the new binding column and centrifuged at 3968 x g for 1 min. The content was washed twice with washing solution 1 and concentrated wash solution and the eluate was discarded. The column was put into a new 2 ml tube and the DNA was collected with elution buffer solution. The concentration (ng/ µl) and quality (260/280 and 260/230 ratio) of the collected DNA was determined by NanoDrop® - 2000 spectrophotometer (Thermo Fischer Scientific Inc. Waltham MA, USA). The genomic DNA was stored at -20°C until use.
 
16S rRNA gene sequencing
 
According to the recommendation by ClarridgeIII (2004), the final identification of the isolates to species level was performed by sequencing the 16S RNA gene. The oligonucleotide sequences: Forward:5’TCCTACGGGAGGCAGCAG3’Reverse: 5’ CGGTTACCTTGTTACGACTT 3’  primers described by Vebø et al. (2011) were used to amplify the 16S rRNA gene with expected 1200 bp product. The amplification was conducted with a final PCR reaction volume of 50 µl. It contained, 5 µl of 10x ThermopolTm  reaction buffer (BioLabs, New England, USA), 0.25 µl Taq Polymerase of 5,000 µ/ml ( BioLabs), 1 µl of each primer of 10 pMol con,  1 µl  of  10 Mm deoxynucletide  triphosphate  mixture  (Sigma-Aldrich, USA) 2 µl of genomic DNA and finally adjusted to final volume of 50 µl with milliQwater. The amplification was carried out in C1000 TMThermal cycler (BIO RAD laboratories) programmed to initial denaturation of 95°C for 1 min, 30 cycles of 95°C for 30 sec., 55°C for 30 sec. 68°C for 80 s and a final extension period at 68°C for 5 min.
 
After amplification, the expected PCR product (1200 bp) was verified by gel-electrophoresis (Figure 2) and purified by QIAquick R PCR purification kit (QIAGEN®, Oslo, Norway) as per the company’s procedures. The purified PCR products were mixed with the same primer and sent to GATC Biotech AG (European Genome and Diagnostic Centre, Konstanz, Germany) for sequencing as per the company´s instructions. The sequence results were bioedited (BioEdit version 7.0.0) and compared in GenBank using the nucleotide BLAST algorithm (http://www.ncbi.nlm.gov/blast). Maximum identification at species level was considered with result scores of 99 to 100% that appear in the first row. 
 
 
Statistical analysis
 
Descriptive statistics (mean, max., min. SD, median) and log-transformed counts was calculated using Microsoft Excel (Windows version 8.1 version). Epi infoTM version 7.1.3.10 (CDC, Atlanta, USA) was utilized to analyse rates, confidence intervals (CI) and significant associations between explanatory variables (type of samples, different localities, sampling points) and the contaminations. Difference with P-values <0.05 was considered as statistically significant.

 


 RESULTS

S. aureus in milk and milk products
 
The overall point prevalence of S. aureus in both raw milk and milk products was 38.7% (95% CI 33.4 to 44.2%) with a mean count of 4.35 ± 0.97 log 10 CFU ml -1. A significant difference (P< 0.05) in the occurrence of S. aureus was observed between raw bulk milk, 47.0%, (95% CI 39.63 - 54.5%) and milk products, 28.9%, (95% CI 22 – 36.8%) (Table 2).
 
 
S. aureus in dairy products in different localities
 
The prevalence of S. aureus in products in the different geographical localities of the project area is shown in Figure 3. The highest prevalence (56.38%, 95% CI 46.3 to 65.9%) was observed in Shire area and the lowest (8.69 and 95% CI 2.41 - 26.7%) in Maichew area (P<0.05).
 
 
S. aureus at different sampling points in the milk chain
 
Analysis of the prevalence of S. aureus in relation to sampling points in the milk supply chain showed that the prevalence was significantly (P<0.05) higher in samples from cafeterias and restaurants than in samples from other sampling points (Table 3). Odds ratio analysis of two dairy production systems indicated that milk samples from small- scale dairies (46.42%) were twice more likely to be contaminated by S. aureus than samples from traditional dairies (29.49%) (P< 0.05, OR = 2.07). 
 
 
Classification of S. aureus counts
 
Out of the total 120 S. aureus positive samples 41 (34.2 %) contained >5 log10 CFU ml -1  S. aureus.  Classification of samples based on their S. aureus count is shown Table 4.
 
 
Identification of coagulase-negative staphylococcus (CNS) and other microorganisms
 
Based on the microbiological and 16 S r RNA gene sequence results, out of the total 310 milk and milk product samples,  276  (89%)  were  found  contaminated with one or two types of either Staphylococcus species or other microorganisms (Enterococcus and Macrococcus species). From the 276 positive samples, 318 isolates were identified. Coagulase-negative staphylococci (CNS) were found in 51.61% of the samples with a mean count of 6.07±1.21 log10 CFU ml -1. Ten different species of CNS were identified and S. epidermidis was the dominant species (36.13%). The type of identified isolates and their respective microbial load is summarized in Table 5. 
 

 


 DISCUSSION

S. aureus is one of the most important food-borne microorganisms, responsible for SFP. Consumption of 100 ng of Staphylococcus enterotoxin (SE)  produced  by enterotoxigenic strains causes SFP (Hennekinne et al., 2011; Seo and Bohach, 2007).
 
This amount of toxin is produced when the enterotoxigenic S. aureus population is greater than 5 log10 CFU ml -1 (Food and Drug Adminstration, 2012; IESR, 2001). In the present study, 34.4% of the positive samples contained >5 log 10 CFU ml -1 of S. aureus which implies that there was high probability for production of SE. Once SE is produced, it will remain structurally stable and biologically active as it is thermo-stable, and also resistant to low pH, freezing, and to the action of different enzymes. Normal pasteurization does not denature the toxin (Bergdoll and Wong, 2006; Hennekinne et al., 2011; Loir et al., 2003).
 
S. aureus could multiply in wide range of growth limiting determinants such as temperature, aw, NaCI and gaseous atmosphere (Cretenet et al., 2011; Kadariya et al., 2014) and hence samples that contained < 5 log 10 CFU ml -1 of S. aureus could also impose a public health hazard. An increase in time or temperature before consumption could lead to further proliferation of the pathogen and the production of toxins by enterotoxigenic strains if any.
 
The point prevalence of S. aureus in the Shire area is statistically higher (P< 0.5) than the  Maichew  area.  This difference may be attributed to differences in the milk hygiene situation during production, transportation, milk processing or storage. In addition to this situation, the relatively higher annual mean temperature of Shire (21.6°C) may encourage greater growth of the pathogens than Maichew, where the temperature is cooler (17.3°C). In agreement with this suggestion, Luca et al. (1997) reported that S. aureus is more prevalent during the warmest months of the year suggesting the impact of temperature on the prevalence of the pathogen.
 
This study shows that S. aureus was statistically more prevalent (P<0.05) in raw bulk milk than in the milk products. This may be related to the fact that during the traditional milk product preparation such as natural sour milk, butter milk and Ethiopian cottage cheese, the milk usually undergoes a natural spontaneous fermentation and/or is exposed to heat treatment, usually in the range of 50°C to 100°C for 50 to 70 min (Yilma et al., 2007), which may kill the S. aureus. Fermentation process may also reduce the growth of S. aureus as it competes poorly with other microbes like lactic acid bacteria. Whenever there are competing microorganisms in the milk, the growth, and SE production of S. aureus will be decreased as a result of low pH and presence of H2O2  and  possibly other antimicrobial substances (Hennekinne et al., 2011; Loir et al., 2003).
 
The prevalence of S. aureus was significantly higher in cafeteria and restaurant samples than from other sampling points. This situation may occur because the initial S. aureus load from the farm may multiply during transportation, as cold chain facilities are not available in all sampling points, or more S. aureus, from human sources, may contaminate the milk because of poor personal and/or equipment hygiene during the value chain. Although a molecular epidemiological study is required to verify the source, the obtained results indicates that there is need to improving food handlers and equipment hygiene as well as application of cold chain facilities in the milk value chain in order to protect the consumer from milk-borne hazards.
 
The higher prevalence of S. aureus in small-scale dairy farms compared to the traditionally managed dairy (P<0.05) may be associated with the type of milking cows available in the respective farms. In the traditional dairy, the local indigenous zebu breed is usual, whereas in small-scale dairy farms, cross-bred animals are the dominant milking cows. S. aureus is the major causative agent of sub-clinical mastitis in dairy cows (Akineden et al., 2011; Petersson-Wolfe et al., 2010), and consequently a major source of raw milk contamination (Kadariya et al., 2014). However, the susceptibility of the dairy cows to mastitis varies between breeds. Pure dairy cows are 6.3 times and crossbred cows are 3.1 times more likely to be exposed to mastitis than the local zebu breed (Katsande et al., 2013). Therefore, this genetic difference may be a further reason for the difference in the occurrence of S. aureus in the two dairying systems.
 
S. aureus is one of the most important food-borne pathogens in Africa as well as in other parts of world. In Zimbabwe, a prevalence of 75.8% with mean count of 5.4 log10 CFU ml-1 in raw milk and 40% with mean count of 4.7 log10 CFU ml-1 in processed milk was reported (Mhone et al., 2011), which is higher than this study. Poor hygienic practices during production and /or processing may give rise to this situation. In Nigeria, S. aureus was reported in the range of 25 to 45% in locally produced fermented milk, Nono (Nnadi, 2006) while in Pretoria, South Africa, 40% of the milk samples collected from milk shops were found to be contaminated with S. aureus (O`Ferrall-Berndt, 2003). Milk collected from large and small-scale dairy farms in Kenya for a multidrug resistance study reported a 30.6% prevalence of S. aureus  (Shitandi and Sternesj, 2004). The aforementioned similar prevalence of S. aureus in milk and milk products indicates that S. aureus is one the most important public health concerns and warrants further attention in the improvement of food safety in Africa.
 
In Europe, Asia and USA, S. aureus has become one of the most important milk-borne pathogens. S. aureus was reported at a prevalence  of  62%  at  dairy farms  in Minnesota, USA, (Haran et al., 2011) and at prevalence of 26% from milk-producing herds in Ireland (Murphy et al., 2010). In Italy, 43% of raw milk intended for Caprino cheese making (Foschino et al., 2002) and 68% of raw milk from the Reconcavo area, Brazil (Oliverira et al., 2011)  was positive for S. aureus. In India, a prevalence ranging from 61.7 to 65.6% was reported in raw cow’s milk (Lingathurai and Vellathurai, 2010; Singh et al., 2010). Similar to this study, all the above surveys showed the importance of S. aureus in the milk supply chain of the respective areas.
 
In this study, the presence of 51.61% CNS with a mean count of 6.07±1.21 log10 CFU ml-1 in the samples indicated that the hygienic condition of the milk and milk products, during production, transportation, processing and storage was poor and needs attention for improvements. In a similar research conducted in Sudan by Suliman and Mohamed (2010), out of 644 raw milk samples, 44.7% were positive for CNS, which is lower than that of this study, however, similar to this study finding, the dominant species was S. epidermidis. In addition to the above hygiene-related implications, the finding of high percentage of CNS in the milk and milk product may have some risk associated with Staphylococcal Food Poisoning. Recent research outputs reported the enterotoxinogenic potential of CNS (Guimaråes et al., 2013; Loir et al., 2003; Madhusoodanan et al., 2011; Park et al., 2011; Vera et al., 2010) and the involvement of CNS in SFP. Podkowik et al. (2013), confirmed the presence of localized elements in the genome of some CNS which are involved in the coding and production of SE. A food-borne disease outbreak caused by S. epidermidis was also reported in USA (Breckinridge and Bergdoll, 1971). These facts necessitate further screening of the CNS for enterotoxinogenic potential.


 ACKNOWLEDGEMENTS

This study was financially supported by the academic collaboration project between Mekelle University (MU) and Norwegian University of Life Sciences (NMBU). The authors also thank the technical staff and others at the College of Veterinary Medicine, MU, and NMBU, for their assistance.



 REFERENCES

Abera M, Demie B, Aragawi K, Regassa F, Regassa A (2010). Isolation and identification of Staphylococcus aureus from bovine mastitic milk and their drug resistance pattern in Adama town, Ethiopia. J. Vet. Med. Animal Health 2:29-34.
 
Ahmed M, Ehui S, Assefa Y (2003). Dairy Development in Ethiopia: Socio-economics and policy Research, working paper 58. International Livestock Research Insititute (ILRI).
 
Ahmed M, Ehui S, Assefa Y (2004). Dairy Development in Ethiopia: Socio-economic and policy research working paper 123.
 
Ahmed Y, Carolyn C (2003). Food Microbiology. A Laboratory Manual. John Wiley Sons, New Jersey.
 
Akineden O, Annemuller C, Hassan AA, Låmmler C, Wolter W, Zschock M (2001). Toxin genes and other characterstics of Staphylococcus aureus isolates from milk of cows with mastitis. Clin. Diagn. Lab. Immunol. 8:959-964.
 
Akineden O, Hassan AA, Schneider E, Usleber E (2011). A coagulase-negative variant of Staphylococcus aureus from bovine mastitis milk. J. Dairy Res. 78:38-42.
Crossref
 
Angulo FJ, LeJeune JT, Rajala-Schultz PJ (2009). Unpasteurized Milk: A Continued Public Health Threat. Clinical Infectious Diseases 48:93-100.
Crossref
 
Argudin MÅ, Mendoza MC, Rodicio MR (2010). Food Poisoning and Staphylococcus aureus Enterotoxins. Toxins 2:1751-1773.
Crossref
 
Bennett RW, Hait JM (2011). BAM: Staphylococcal Enterotoxins. USA Food and Drug Adminstaration.
 
Benntt W, Lancette GA (2001). BAM: Department of Health and Human Services, 8th edition ed. US Food and Drug Adminstration.
 
Bergdoll MS, Wong ACL (2006). Staphylococcal intoxications, 3rd edition ed. Elsever Inc.
Crossref
 
Breckinridge JC, Bergdoll MS (1971). Outbreak of Food-Borne Gastroenteritis Due to a Coagulase-Negative Enterotoxin-Producing Staphylococcus. New England J. Med. 284:541-543.
Crossref
 
CDC, CfDCaP (2009). Surveillance for food-borne diseases outbreaks-Uinted States, pp. 609-615.
 
ClarridgeIII JE (2004). Impact of 16S rRNA Gene Sequence Analysis for Identification of Bacteria on Clinical Microbiology and Infectios Diseases Clinical Microbiol. Reviews 17:840-862.
 
Cretenet M, Even S, Loir YL (2011). Unveiling Staphylococcus aureus enterotoxin production in dairy products: a review of recent advances to face new challenge. Dairy Sci. Technol. 91:127-150.
Crossref
 
European Food Safety Authority (2010). The community summary report on trend and sources of zoonoses and zoonotic agents and food-borne outbreaks in the European Union in 2008. The EFSA.
 
Food and Drug Adminstration (2012). Bad Bug, Foodborne Pathogenic Microorganisms and Natural Toxins, second ed, USA.
 
Foschino R, Invernizzi A, Barucco R, Stradiotto K (2002). Microbial composition, including the incidence of pathogens of goat milk from the Bergamo region of Italy during a lactation year. J. Dairy Res. 69:213-225.
Crossref
 
Guimaråes FdF, Nøbrega DB, Richini-Pereira VB, Marson PM, Pantoja JCdF, Langoni H (2013). Enterotoxin genes in coagulase-negative and coagulase-positive staphylococci isolated from bovine milk. J. Dairy Sci. 96:2866-2872.
Crossref
 
Haran KP, Godden SM, Boxrud D, Jawahir S, Bender JB, Sreevatsan S (2011). Prevalence and Characterization of Staphylococcus aureus, including Methicillin Resistant Staphylococcus aureus, Isolated from Bulk Tank Milk from Minnesota Dairy Farms. J. Clinical Microbiol. 50:688-695.
Crossref
 
Hennekinne JA, Buyser MLD, Dragacci S (2011). Staphylococcus aureus and its food poisoning toxins: characterization and outbreak investigation. FEMS Microbiol Rev. 1-22.
 
IESR, IoESaRL (2001). Staphylococcus aureus. New Zealand Ministry of Health, pp. 1-4.
 
Kadariya J, Smith TC, Thapaliya D (2014). Staphylococcus aureus and Staphylococcal Food-Borne Disease: An Ongoing Challenge in Public Health. BioMed Res. Intl. P 9.
Crossref
 
Katsande S, Matope G, Ndengu M, Pfukenyi DM (2013). Prevalence of mastitis in dairy cows from smallholder farms in Zimbabwe. The Onderstepoort J. Vet. Res 80:523.
Crossref
 
Lingathurai S, Vellathurai P (2010). Bacteriological Quality and Safety of Raw Cow Milk in Madurai, South India. Webmedcentral, 1-10.
 
Loir YL, Baron F, Gautier M (2003). Staphylococcus aureus and Food poisoning. Genet. Mol. Res. 2:63-76.
 
Luca GD, Zanetti F, Stampi S (1997). Staphylococcus aureus in dairy products in the Bologna area. Intl. J. food microbial. 35:267-270.
 
Madhusoodanan J, Seo KS, Remortel B, Park JY, Hwang SY, Fox LK, Park YH, Deobald CF, Wang D, Liu S, Daugherty SC, Gill AL, Bohach GA, Gill SR (2011). An Enterotoxin-Bearing Pathogenicity Island in Staphylococcus epidermidis. J. Bacteriol. 193:1854-1862.
Crossref
 
Makita K, Desissa F, Teklu A, Zewde G, Grace D (2012). Risk assessment of staphylococcal poisoning due to consumption of informally-marketed milk and home-made yoghurt in Debre Zeit, Ethiopia. Intl. J. food microbiol. 153:135-141.
Crossref
 
Meyrand A, Boutrand-Loei S, Ray-Gueniot S, Mazuy C, Gaspard CE, Jaubert G, Perrin G, Lapeyre C, Vernozy-Rozand C (1998). Growth and enterotoxin production of Staphylococcus aureus during the manufacture and ripening of Camembert-type cheeses from raw goats' milk. J. Appl. Microbiol. 85:537-544.
Crossref
 
Mhone TA, Matope G, Saidi PT (2011). Aerobic bacteria, coliforum, Escherichia coli and Staphylococcus aureus counts of raw and processed milk from selected small holder dairy farms of Zimbabwe. Intl. J. Food Microbiol.
Crossref
 
Murphy BP, O`Mahony E, Buckley JF, Brien SO, Fanning S (2010). Characterization of Staphylococcus aureus isolated from Dairy Animals in Ireland. Zoonoses and Public Health 57:249-257.
Crossref
 
Nnadi EI (2006). Incidence of Staphylocccus aureus in locally produced fresh milk (nono) sold in Damaturu metropolis, Yobe State, Nigeria. Intl. J. Agric. Rural Dev. 7:99-106.
 
O`Ferrall-Berndt MM (2003). A comparison of selected public health criteria in milk from milk-shops and from a national distributor. . JIS. Afr. Vet. Ass. 74:35-40.
 
Oliverira LPd, Barros LSSe, Silva VC, Cirqeira MG (2011). Study of Staphylococcus aureus in raw and pasteurized milk consumed in the Reconcavo area of the state of Bahia, Brazil. J. Food Processing Technology 2.
 
Ortega E, Abriouel H, Lucas R, Gålvez A (2010). Multiple Roles of Staphylococcus aureus Enterotoxins: Pathogenicity, Superantigenic Activity, and Correlation to Antibiotic Resistance. Toxins 2:2117-2131.
Crossref
 
Park JY, Fox LK, Seo KS, McGuire MA, Park YH, Rurangirwa FR, Sischo WM, Bohach GA (2011). Detection of classical and newly described staphylococcal superantigen genes in coagulase-negative staphylococci isolated from bovine intramammary infections. Vet. Microbiol. 147:149-154.
Crossref
 
Petersson-Wolfe CS, Mullarky IK, Jones GM (2010). Staphylococcus aureus Mastitis: Cause, Detection and Control. Virginia Coopertaive Extension.
 
Podkowik M, Park JY, Seo KS, Bystroń J, Bania J (2013). Enterotoxigenic potential of coagulase-negative staphylococci. Intl. J. food microbiol. 163:34-40.
Crossref
 
Redda T (2001). Small - Scale Milk Marketing and Processing in Ethiopia., In: South - South Workshop on Smallholder Dairy Production and Marketing- Constraints and Opportunities, Anand, India.
 
Rosec JP, Gigaud O (2002). Staphylococcal enterotoxin genes of classical and new types detected by PCR in France Intl. J. Food Microbiol. 77:61-70.
Crossref
 
Seo KS, Bohach GA (2007). Staphylococcus aureus, In: Food Microbiology, FUNDAMENTALS AND FRONTIERS, 3rd ed. ASM Press, Washington, DC, pp. 493-518.
Crossref
 
Shitandi A, Sternesj ÖÅ (2004). Prevalence of Multidrug resistant Staphylococcus aureus in Milk from Large and Small-scale producers in Kenya. J. Dairy Sci. 87:4145-4149.
Crossref
 
Singh P, Prakash A (2010). Prevalence of coagulase positive pathogenic Staphylococcus aureus in mil k and mil k products collected from unorganized sector of Agra Acta agriculture Slovenica 96.
 
Sori T (2011). Prevalence and Susceptibility Assay of Staphylococcus aureus isolated from Bovine Mastitis in Dairy Farms of Jimma Town, South West Ethiopia. J. Animal Vet. Advan. 10:745-749.
 
Suliman AMA, Mohamed TEt (2010). Factors determining the load of Staphylococci species from raw bovine milk in Khartoum State, Khartoum North, Sudan. J. Cell Animal Biol. 4:19-24.
 
Vebø HC, Sekelja M, Nestestog R, Storrø O, Johnsen R, Øien T, Rudi K (2011). Temporal Development of the Infat Gut Microbiota in Immunoglobulin E-Sensitized and Nonsensitized Childern Determined by the GA-Map Infant Array. Clinic. Vaccine Immunol. 18:1326-1335.
Crossref
 
Vera LMR, Jose MS, Maria FRdD, Daniel CdS, Carlos HC, Nataålia CG, Luciane AG, Taissa CSS, Joåo PA (2010). Polymerase Chain Reaction Detection of Enterotoxins Genes in Coagulase- Negative Staphlococci Isolated from Brazilian Minas Cheese. Foodborne Pathogens and Disease P 7.
 
Wang S, Duan H, Zhang W, Li JW (2007). Analysis of bacterial foodborne disease outbreaks in China between 1994 and 2005. FEMS Immunol. Med. Microbiol. 51:8-13.
Crossref
 
Yilma Z, Faye B, Loiseay G (2007). Occurrence and distribution of species of Enterobacteraceae in selected Ethiopian traditional dairy products: A contribution to epidemiology. Food Control 18:1397-1404.
Crossref

 




Copyright © 2024 Author(s) retain the copyright of this article.

This article is published under the terms of the Creative Commons Attribution License 4.0

Back to Vol. 9 No. 12
Back to articles
SUBSCRIBE TO RSS
SUBMIT MANUSCRIPT
CONFERENCES
          */?>