Articles

 

Page 8 of 1135, showing 50 records out of 56709 total, starting on record 351, ending on 400

July 2018

African Journal of Agricultural Research
“Climate change perception and adaptation strategy associated with farming techniques in Tamou district wester Niger” farmers

The variability of climate parameters in most of agricultural areas in Niger represents a major risk for farmers. This work is aimed at analyzing farmer’s perception and adaptation to climate change parameters in Tamou district. The study was conducted on seventy three (73) millet farmers from seven villages in Tamou, namely Allambaré, Bani Guiti, Guieme, Tollondi , Moli Haoussa and Welgorou. The sample was...

Author(s): Mamane Baragé, Baragé Moussa and Jacques Comby  

July 2018

African Journal of Agricultural Research
Cowpea response to nutrient application in Burkina Faso and Niger

Cowpea (Vigna unguiculata (L.) Walp) is important in semi-arid West Africa. Yields are low due to inadequate water and nutrient availability and other constraints. Grain and fodder yield responses to nutrient application were determined from 21 site-years of research conducted in the Sahel and Sudan Savanna. The incomplete factorial treatment arrangement varied by country but included: Four levels each of P and K in 7.5...

Author(s): Idriss Serme, Nouri Maman, Maman Garba, Abdoul Gonda, Korodjouma Ouattara, and Charles Wortmann  

July 2018

African Journal of Agricultural Research
Cultivation of watermelons submitted to water deficit in the experimental area of Brazilian semiarid

The culture of watermelon is mostly responds to technological advancement. The fruit is analyzed in terms of its production and quality. Among the factors involved in its production, irrigation is very important; however it must be well managed. There are phases of the culture that requires greater or lesser amount of water for maximum productivity and high quality. In this context, the present research was conducted to...

Author(s): N. N. Veras, V. L. A. Lima, M. Valnir, J. Suassuna and V. F. Silva  

July 2018

African Journal of Agricultural Research
Humic acids and brassinosteroid application effects on pineapple plantlet growth and nutrition during the aclimatization phase

Humic acid and brassinosteroid applications may be an alternative to decrease the pineapple plantlet acclimatization in in vitro cultivation, since promising results have been observed when these substances were independently applied in other propagation methods. In this sense, the aim of the present study was to evaluate the effects of humic acids and brassinosteroid application on 'BRS Vitória'...

Author(s): Paulo Cesar dos Santos, Almy Junior Cordeiro de Carvalho, Mírian Peixoto Soares da Silva, Diego Alves Peçanha, Aurilena de Aviz Silva, Tiago Massi Ferraz and Marta Simone Mendonça Freitas  

July 2018

Journal of Medicinal Plants Research
Medicinal plants used in the treatment of livestock diseases in Berbere district of Bale zone, Oromia region, Ethiopia

An ethnoveterinary study of medicinal plants used by local people of Berbere district was carried out from June 25 to September 5, 2015. The study was focused on utilization of medicinal plants to treat various livestock health problems by people of the study area. The data were gathered using semi-structured interview, participant observation and personal interviews. A total of 69 informants (55 male and 14 female) in...

Author(s): Tilahun Tolossa Jima  

July 2018

Journal of Medicinal Plants Research
Plants and their metabolites against Streptococcus mutans

Oral diseases represent a major public health problem, especially for economically marginalized communities with limited access to health services. In addition, the constant increase in bacterial resistance to many of the antibiotics contributes to worsen the problem. In this context, great importance had been given to natural compounds for the discovery of new drugs that contribute to the prevention and control of oral...

Author(s): Landi B. O., Di Pace B. and Conceição A. O.  

July 2018

Journal of Medicinal Plants Research
Quantitative analyses of phytochemical and trace elements contents of daily detox, herbal tea consumed in Nigeria

Tea is one of the commonest drinks in most homes. Many people consume tea due to its unique taste and associated health benefits. Several medical disorders such as cancer, cardiovascular diseases and diabetes mellitus have been linked to the excessive generation of free radicals and oxidative stress. Studies conducted on Daily Detox, a tea consumed by many Nigerians have been limited to qualitative assessment of...

Author(s): Orimadegun B. E., Bolajoko E. B., Onyeaghala A. A. and Ademola-Aremu O. O.  

July 2018

African Journal of Biotechnology
Biotransformation of the residual liquid from the wet coffee benefit by Kluyveromyces marxianus

The search for biotechnological alternatives for the use of residuals generated in the agro-industrial processing of coffee is a current problem. This study evaluated the biotransformation of the liquid residual of the humid coffee benefit using the yeast Kluyveromyces marxianus CCEBI 2011. It was demonstrated that this strain is able to effectively use the reducing and neutral sugars in 24 h, for a yield of 40% in the...

Author(s): Cassamo Ussemane Mussagy, Kodjovi Kekeli Agbozouhoue and Manuel Serrat-Díaz  

July 2018

African Journal of Biotechnology
Evaluation of Curcuma zerumbet (Zingibaraceae) rhizome extracts sub-acute toxicity on Wistar rats

Plant extracts have been lately used by the population to treat various types of diseases, and this has been notably encouraged by the World Health Organization (WHO). Curcuma zerumbet (Zingiberaceae) belonging to the family of the Zingiberaceae, is herbaceous, perennial and, utilized by the population to treat gastric disorders. However, data on the subacute toxicity of this species are scarce in the literature....

Author(s): Márcia Seixas de Castro, Carlos Cleomir de Souza Pinheiro, Helyde Albuquerque Marinho and Amadis Batista Francisco  

July 2018

African Journal of Biotechnology
Biosurfactant production by Bacillus subtilis UFPEDA 86 using papaya (Carica papaya L.) waste as substrate: Viability studies and pH influence of the culture medium

Biosurfactants are surface-active compounds derived from microorganisms and offer several advantages over chemical surfactants, such as low toxicity, good biodegradability and ecological acceptability. Even though interest in biosurfactants is increasing, these bioproducts do not compete economically with synthetic surfactants due to the overall costs of the bioprocess. The use of inexpensive raw materials is an...

Author(s): Camylla Carneiro Soares, Adrielly Silva Albuquerque de Andrade, Gabriela Fontes Deiró Ferreira, Andrea Farias de Almeida, Janice Izabel Druzian and Ana Katerine de Carvalho Lima Lobato,  

July 2018

Educational Research and Reviews
Commenting on effective laboratory teaching in selected preparatory schools, North Shewa Zone, Ethiopia

The present study assessed the challenges to implement laboratory teaching in selected Preparatory Schools, North Shewa Zone. The result of this study showed that although laboratories for each subjects were present (100%) in all districts, lack of professional skills (50% in biology, 64.5% in chemistry and 61.5% physics), lack of materials (78.6% in biology, 64.7% in chemistry and 65.4% in physics) and lack of...

Author(s): Andinet Nigussie, Said Mohammed, Endris Yimam, Worku Wolde, Negasi Akalu, Abubekir Seid, Genene Shiferaw, Tesfaye Teka and Solomon Mulaw  

July 2018

Educational Research and Reviews
Pedagogical development level of pre-service primary school teachers for science teaching

In this study, the pedagogical development level of pre-service primary school teachers for science teaching was examined. The participants of the study consist of 135 pre-service teachers from Primary School Teaching Department in Faculty of Education at Pamukkale University. After removing the invalid forms, a total of 128 pre-service teachers participated in the study. Data were collected with “Pre-service...

Author(s): Ümran Şahin  

July 2018

Educational Research and Reviews
Analysis of preschool curriculum in East Gojjam Zone: Implication to quality early childhood education

Developmentally appropriate curriculum is a component for quality early childhood care and education. This study was conducted in Debre Markos town, East Gojjam Zone, Ethiopia. The study aimed to evaluate if the textbooks implemented by private preschools are developmentally appropriate or not. Qualitative case study approach was employed and Mathematics and Environmental Science textbooks for upper kindergarten class...

Author(s): Wohabie Birhan  

July 2018

Educational Research and Reviews
Explaining the requirements for teacher’s development based on professional competencies approach

As teacher competencies and skills play a major role in their performance and thus the achievement of school and educational goals, teachers need to equip themselves with a variety of competencies to educate children who are potentially future leaders of the community. In this context, the present study aimed to find the correlation between each of the main dimensions of professional competencies and the main components...

Author(s): Leila Moghtadaie and Maryam Taji  

July 2018

African Journal of Pharmacy and Pharmacology
Assessment of antimalarial activity and proteomics analysis of Dioscorea membranacea Pierre.

Multidrug resistance Plasmodium falciparum remains a significant global health problem worldwide. New alternative antimalarial drugs are urgently needed. Dioscorea membranacea Pierre. is a Thai-medicinal plant that has been shown to exhibit a wide range of pharmacological activities. The study aimed to investigate antimalarial activity and possible protein targets of action of the crude ethanolic extract of the rhizome...

Author(s): Phunuch Muhamad, Luxana Panrit, Artitiya Thiengsusuk, Wanna Chaijaroenkul and Kesara Na-Bangchang  

July 2018

African Journal of Pharmacy and Pharmacology
Ethnomedicinal plants used for the treatment of gastro-intestinal parasitic diseases in human in Yeki district, Southwest Ethiopia

The use of medicinal plants plays a major role in the primary health care of human beings in Ethiopia. A study was carried out to document ethnomedicinal plants used for the treatment of gastrointestinal parasitic diseases of human in Yeki district, southwest Ethiopia. The key informants were selected using purposive sampling method. The information was obtained from 26 informants and 8 herbalists through the use of a...

Author(s): Belachew Garedew and Dagne Abebe  

July 2018

African Journal of Microbiology Research
Study on prevalence and genetic discrimination of methicillin-resistant Staphylococcus aureus (MRSA) in Egyptian hospitals

Methicillin-resistant Staphylococcus aureus (MRSA) continues to be a global problem in infection control. The highest proportions of MRSA are reported by Jordan, Egypt and Cyprus investigators, where more than 50% of the invasive isolates are methicillin-resistant. The aim of this work was to study the prevalence, antibiotic sensitivity and genetic discrimination of MRSA in Egypt. Microbiological identification was done...

Author(s): Rana Elshimy, Rania Abdelmonem Khattab, Hamdallah Zedan, Alaa El-Din Shawky Hosny and Tarek H. Elmorsy  

July 2018

African Journal of Microbiology Research
Paediatric tuberculosis in a low burden setting of Saudi Arabia: Drug and multidrug resistance patterns

In this study, the infection of young children with Mycobacterium tuberculosis and drug-resistant M. tuberculosis in a mass gathering area in Al-Madinah Al-Munawwarah, was investigated and discussed. All the children, 15 years old and younger, who were referred to the central tuberculosis laboratory in Al-Madinah between January 2012 and December 2014 were included in this study. Among a total of 622 registered new...

Author(s): Mogahid M. Elhassan, Miskelyemen A. Elmekki, Hani A. Ozbak, Hassan A. Hemeg, Khalid A. Turkistani, Shamsoon K. Kafi and Ahmed A. Abdul-Aziz

July 2018

African Journal of Microbiology Research
Identification and molecular phylogeny analysis using random amplification of polymorphic DNA (RAPD) and 16SrRNA sequencing of N2 fixing tea field soil bacteria from North Bengal tea gardens

Random amplification of polymorphic DNA (RAPD) amplification genomic DNA of 23 selected laboratory cultures of bacteria using RAPD revealed their polymorphism. Polymerase chain reaction (PCR) amplification of the bacterial 16SrDNA was performed using 704F GTAGCGGTGAAATGCGTAGA and 907R CCGTCAATTCCTTTGAGTTT primer, sequenced and accessed in NCBI (No. KY636356, KY631488, KY 860028, KX587470, KX665547, KY631489, KX608591,...

Author(s): Jayanta Bhaduri, Pritam Kundu and Subhash Kanti Roy  

July 2018

African Journal of Agricultural Research
Thorn apple (Datura stramonium L.) allelopathy on cowpeas (Vigna unguiculata L.) and wheat (Triticum aestivum L.) in Zimbabwe

Datura stramonium extracts have allelopathic properties. The study was conducted to investigate the allelopathic effects of D. stramonium weed on seed germination, early seedling growth and dry biomass of crop plants (Triticum aestivum and Vigna unguiculata). Laboratory and greenhouse trials were arranged as completely randomised design and the field pot experiment was arranged as a randomised complete block design....

Author(s): Nyasha Sakadzo, Pahla Innocent, Muzemu Simbarashe, Mandumbu Ronald and Makaza Kasirayi  

July 2018

African Journal of Agricultural Research
Analysis of coffee quality along the coffee value chain in Jimma zone, Ethiopia

This study assesses the effect of cooperative, certification, private trader, farmers, sorting and processing methods on Arabica coffee quality. Coffee samples were collected from certified cooperatives, non-certified cooperatives, private traders and farmers (members of certified cooperatives, non-certified cooperatives and non-members of cooperatives). The study showed that coffee beans sampled from cooperatives had...

Author(s): Kassaye Tolessa, Luc Duchateau and Pascal Boeckx  

July 2018

African Journal of Agricultural Research
Sensor-based algorithms to improve barley nitrogen efficiency in Queensland

The low efficiency of nitrogen (N) fertilizers impels the innovation of current N management strategies in cereal production. Site specific N management is an emerging field providing novel alternatives to current nutrient management practices through canopy sensing. Barley N use efficiency can be enhanced with GreenSeeker proximal sensors, whose optimal utilization requires algorithms. The design of such algorithms...

Author(s): Paul Theophile Epee Misse, and Madan Gupta  

July 2018

African Journal of Agricultural Research
Screening of cowpea (Vigna unguiculata (L.) Walp.) lines for resistance to three Aphids (Aphis craccivora Koch) strains in Burkina Faso

Cowpea (Vigna unguiculata L. Walp.) is an important cash, food and nutritional security grain legume crop in the semi-arid regions of sub-Saharan Africa. However, its productivity is hampered by several biotic stress factors including numerous insect pests that infest and damage the crop at all its development stages in the field as well as during storage. This study sought to identify new sources of resistance to...

Author(s): Adelaїde P. Ouédraogo, Benoit J. Batieno, Fousseni Traore, Jean-Baptiste Tignegre, Bao-Lam Huynh, Philip A. Roberts, Timothy Close and Jeremy T. Ouédraogo  

July 2018

African Journal of Biotechnology
Rapid and efficient plant regeneration from shoot apical meristems of finger millet [Eleusine coracana (L.) Gaertn.] via direct organogenesis

A simple and efficient plant regeneration system via direct organogenesis was established in finger millet using in vitro derived shoot apical meristems. Six varieties; GBK-043128, GBK-043094, GBK-043050, GBK-043137, GBK-043122 and GBK-043124 were evaluated. MS medium was used for cotyledonary germination. Maximum number of shoots (84.33%) was observed in variety GBK-043128 while GBK-043094 had the least germination...

Author(s): Asunta Mukami, Alex Ngetich, Cecilia Mweu, Mutemi Muthangya, Richard O. Oduor, Mathew Ngugi and Wilton Mbinda  

July 2018

African Journal of Biotechnology
Assessment of morphological characteristics among upland rice (Oryza sativa and Oryza glaberrima) germplasm

Rice is an important staple food crop that feeds over half of the global population and has become the cereal that provides a major source of calories for the urban and rural poor in Africa. This work aimed to evaluate the morphological of rice (Oryza sativa and Oryza glaberrima) germplasm. In the present study, 14 quantitative traits were used across 48 accessions or genotypes obtained from Central Agricultural...

Author(s): Zogbo Luther, Richard Akromah, David P. Tokpah and Zipporah Page  

July 2018

International Journal of Physical Sciences
Theoretical models for prediction of methane production from anaerobic digestion: A critical review

This work presents a critical analysis for three models group of methanogen potential prediction. The first group allows determination of the methane productivity of substrates, through three models (BMPthCOD, BMPthAtC and BMPthOFC). The BMPthCOD is suitable for a first approximation calculation. BMPthAtC and BMPthOFC are more accurate; however, require a complex characterization of substrates. The second models group...

Author(s): Mohamed Mahmoud ALI, Nourou DIA, Boudy BILAL and Mamoudou NDONGO  

July 2018

Scientific Research and Essays
Indigenous knowledge on highland bamboo (Yushania alpina) management and utilization practices in Kokosa Woreda, South East Ethiopia

Bamboo is one of the world’s most important non-timber forest products (NTFPs) which have been advocated for poverty alleviation in many regions. However, in Ethiopia it is utilized below its potential due to lack of scientific knowledge and awareness on its management and utilization. Therefore, the main objective of this study was to investigate the indigenous knowledge of highland bamboo management and...

Author(s): Seyoum Gebrekidan, Lemma Tiki and Yigardu Mulatu  

July 2018

African Journal of Business Management
Diversity management discourse: An African perspective

This paper reviews the concept of diversity across selected sub-Saharan Africa countries. It focuses on the impact of social relations that depict cultural and social identities of individuals within these African countries. This is with the aim to help corporations develop diversity management strategies for their workforce. Consequently, this narrative paper adopts a qualitative approach, a literature survey that...

Author(s): Loliya Akobo and Osikwemhe Damisah  

July 2018

African Journal of Business Management
Attaining competitive advantage through energy efficiency: A cooperative strategic perspective

The Kenyan economy in the recent past has witnessed a considerable exit of multinational companies due to high-energy costs. Similarly, a comparative analysis among the East African community partners places the country among the list of those nations with high-energy charges levied on consumers. This phenomenon disadvantages the competitiveness of local industries while discouraging potential players. This is...

Author(s): Kiptum Henry Yatich  

July 2018

African Journal of Business Management
Prototyping an innovative e-platform of financial assistance for small medium enterprises in Mauritius

The SMEs form a vibrant pillar of the Mauritian economy through their important contribution to Gross Domestic Product (GDP) growth and socio-economic development. SMEs are recognized for their significance and their resilience in responding to fast changing conditions, even in times of the economic downturn. This paper aims to address financial illiteracy among Mauritian SMEs by proposing an integrated financial...

Author(s): Padachi K., Narrainen D. and Boolaky A.  

July 2018

African Journal of Microbiology Research
Isolation of bacterial diversity present in medical waste and health care settings in hospitals in Kenya

Nosocomial infections have impacted great burden in healthcare system and has led to deteriorating health condition and deaths. This study characterizes medically important bacterial diversity, isolated from staff hands, hospital surfaces and wastes in healthcare settings in Kenya during a one year period. Descriptive cross sectional hospital based study design and simple random sampling method was used to collect 246...

Author(s): Susan Muthoni Maina, Andrew K. Nyerere and Caroline Wangari Ngugi  

July 2018

African Journal of Microbiology Research
Fungal endophytes isolated from the leaves of a medicinal plant, Ocimum sanctum Linn and evaluation of their antimicrobial activities

The endophytic fungi isolated from leaves of Ocimum sanctum Linn. of different ages were examined for antimicrobial activity. The agar plug diffusion assay was used for primary screening. A total of 148 fungal endophytes were successfully isolated and cultured but only 134 of them (90.5%) exhibited inhibitory activity towards at least one test microorganisms. Moreover, the colonization rate indicated that the old leaves...

Author(s): Taufiq M. M. J. and Darah I.  

July 2018

African Journal of Microbiology Research
Microbiological quality of fruit juices sold in cafes and restaurants of Shewarobit town, Amhara, Ethiopia

Fresh and unpasteurized fruit juice is common in restaurants, cafeteria, hotels and juice house of Ethiopian cities. Most fruit juices contain sufficient nutrients that could support microbial growth. The current investigation was carried out to investigate the microbiological quality and processing conditions of fruit juice vended in Shewarobit town. Purposive sampling technique was employed to collect sixteen fruit...

Author(s): Bulti Kumera Fufa and Melkam Dessalegn Liben  

July 2018

African Journal of Agricultural Research
Technical efficiency and yield gap of smallholder wheat producers in Ethiopia: A Stochastic Frontier Analysis

Improving technical efficiency of smallholder farmers is one of the options to increase wheat yield in developing countries. This paper assesses technical efficiency, factors for inefficiency and the yield gap due to technical inefficiency in major wheat producing regions of Ethiopia, where the support to agricultural research for development of strategic crops (SARD-SC) wheat project has been implemented using primary...

Author(s): Tadele Mamo, Wudineh Getahun, Ali Chebil, Agajie Tesfaye, Tolessa Debele, Solomon Assefa and Tesfaye Solomon  

July 2018

African Journal of Agricultural Research
Direct shoot regeneration from hypocotyl explants of Heracleum candicans Wall: A vulnerable high value medicinal herb of Kashmir Himalaya

Heracleum candicans belongs to the family Apiaceae, and is categorized as a vulnerable Himalayan medicinal herb. Due to its diverse chemical constituents it is having an increased demand in pharmaceutical industries, especially in international market. This herb is commercially useful as a major source of Xanthotoxin which is widely used to treat leucoderma and to prepare suntan lotions. During the present study direct...

Author(s): Mahroofa Jan, Seema Singh, Farhana Maqbool and Irshad Ahmad Nawchoo  

July 2018

African Journal of Agricultural Research
Use of millimeter ruler as an alternative tool in the phenotyping of potential descriptors of soybean

The soybean stands out in the Brazilian agribusiness and part of this success stems from the development of improved cultivars. One of the requirements for the concession of protection to a given cultivar is that it should be distinct from others cultivars. Potential additional descriptors of soybean have been studied. Thus, the aim of this study was to evaluate the performance of the millimeter ruler in the measurement...

Author(s): Ronaldo Machado Junior, Guilherme Ferreira Alves, Victor Afonso Reis Gonçalves, Sylas Clemente Oliveira, Ronaldo Silva Gomes, Paulo Roberto Cecon, Silvana da Costa Ferreira and Eder Matsuo  

July 2018

African Journal of Agricultural Research
Screening for resistance to Striga gesnerioides and estimation of yield loss among Cowpea (Vigna unguiculata (L.) Walp.) progenies in the Upper East Region of Ghana

Parasitic weed Striga gesnerioides (Willd.) is one of the major constraints of cowpea production. Host-plant resistance seems to be efficient and economical in controlling the pest. The objectives of this study were to evaluate recombinant inbred lines developed between IT97K 499-35 (Striga resistant parent,) and Sanzi (susceptible parent), by Single Seed Descent (SSD), for Striga resistance in Northern Ghana. The study...

Author(s): Leandre, S. P., Francis, K., Richard, A., Joseph, B., Jean Baptiste T, Jeremy T. Ouedraogo, Patrick A., Timothy J. Close and Philip A. Roberbs

July 2018

African Journal of Agricultural Research
Cultivation of common bean with the application of biochar of ouricuri (Syagrus coronata (Mart) Becc.) endocarp

Biochar has attracted the attention of the scientific community due to its promising applicability and contribution to the elevation of soil chemical and biological aspects, directly influencing the microbiota, fertility levels and yield of agricultural crops. The objective of this study is to determine the chemical and biological attributes of an acrisol cultivated with beans and submitted to the application of...

Author(s): Felipe Alexandre Tenório, Abel Washington De Albuquerque, Tania Marta Carvalho Dos Santos, João Inácio Soletti, Ferdnando Mariano Brito Silva and Karoline De Melo Padilha  

July 2018

African Journal of Agricultural Research
Greenhouse gas emissions from an alkaline saline soil amended with urea: A laboratory study

Soil of the former lake Texcoco is nitrogen (N) depleted, so any attempt to vegetate the area will require the application of an N fertilizer. Urea is commonly used as fertilizer, but its application to soil might affect emissions of greenhouse gases (GHG), such as carbon dioxide (CO2), nitrous oxide (N2O) and methane (CH4), and the high pH and electrolytic conductivity (EC) in the Texcoco soil might inhibit the...

Author(s): César Valenzuela-Encinas, Leslie Elizalde Contreras, Rocio J. Alcántara-Hernández, Marco Luna-Guido, Olivia Franco-Hernández, Víctor M. Ruíz-Valdiviezo, Luc Dendooven and Rodolfo Marsch  

July 2018

African Journal of Biotechnology
Potential evaluation of Saccharomyces cerevisiae strains from alcoholic fermentation of mango pulp

The fermentation characteristics of different strains of Saccharomyces cerevisiae isolated from sugar cane musts for the production of cachaça (Brazilian sugar cane spirit) and from beer musts were analyzed based on the kinetic parameters of alcoholic fermentation in mango pulp. The commercial pressed baker’s yeast was used as a standard inoculum. The results show that the yeast strains tested from sugar...

Author(s): Cosme Damião Barbosa, Inayara Cristina Alves Lacerda and Evelyn de Souza Oliveira

July 2018

African Journal of Biotechnology
Effects of aqueous seed extracts of Mucuna sloanei (Fabaceae) on body weight and some biochemical parameters of Rattus novergicus

Mucuna sloanei is an annual leguminous plant widely used among the various ethnic groups in Nigeria. The effects of aqueous M. sloanei seed extract on the body weight and some biochemical parameters of 48 normal male Rattus novergicus (albino rats) were investigated for 28 days. The rats were divided into control group (A) which received distilled water and treatment groups (B, C and D) that received oral administration...

Author(s): Ugwu, Godwin C., Ejere, Vincent C., Okanya, Chinagorom L., Omeje, Joy N., Egbuji, Jude V., Onu, Martina C. and Chukwuka, Christian O.

July 2018

African Journal of Biotechnology
Effect of seasonal variations on the yield of essential oil and antioxidant of Achillea fragrantissima (Forssk) Sch. Bip

Temperature stress is becoming the major concern for plant scientists worldwide due to climate change. Temperature stress has devastating effects on plant growth and metabolism. The aim of the study was to investigate the effect of climatic seasonal change on the yield and composition of essential oil of the plant, Achillea fragrantissima. The gas chromatography-mass spectrometry (GC-MS) used to analyze the essential...

Author(s): Eman Elsharkawy, and Nour El-Din M. Nahed

July 2018

Educational Research and Reviews
An analysis on play and playmate preferences of 48 to 66 months old children in the context of gender

This research was conducted to analyze play and playmate preferences of preschool girls and boys during free play time. The study group consisted of 48-66 months old preschool children. There were ten girls, seven boys and a preschool teacher in the study group. They were all selected from a public preschool in Cukurova, a district of Adana a city in the south of Turkey in the fall semester of 2014 to 2015 academic...

Author(s): Işıl Taş

July 2018

Educational Research and Reviews
The effect of physical education and sports departments on behavioral changes towards exercising

This study was conducted to investigate the effects of Physical Education and Sports (PES) Departments over the exercise behaviors of male students (277 pu, 283 pri) from a sample group of 21 to 26 year-olds, who are studying in various departments from both private and public universities in Istanbul. The Physical Activity Stages of Change Questionnaire (PASCQ) was used for data collection and the effect of the PES...

Author(s): Aliye Menevşe

July 2018

Educational Research and Reviews
Comparative study of Turkey and Germany Life Science teaching programs

Comparative education studies within the perspective of globalization are seen as important studies, as they reveal the problems in education and show defective aspects of the systems applied in other countries. This way they improve the available system. The purpose of this research is to study the current curriculum of Life Science lesson within the context of four main elements comparatively. The Life Science lesson,...

Author(s): Tuncay Canbulat

July 2018

Educational Research and Reviews
Existential intelligence among graduate students at the World Islamic Sciences University in Jordan

Existential intelligence is often neglected in literature, especially at the tertiary level. Therefore this study aims to identify the degree of existential intelligence in a sample of graduate students at the World Islamic Sciences University in Jordan. In addition, the study aims to find out whether this degree differs according to a number of variables. The study sample comprised 56 male and female Faculty of...

Author(s): Esam Abdullah Al Jaddou  

July 2018

Journal of Medicinal Plants Research
Evaluation of Procavia capensis hyraceum used in traditional medicine for antioxidant activity

Hyraceum (HM) used in traditional medicine in Southern Africa is produced by the herbivore Procavia capensis. It is fossilized excreta derived from urine, faecal matter and plant material. In this study a qualitative phytochemical screening, determination of the in vitro antioxidant activity using the 1, 1-Diphenyl-2-picrylhydrazyl (DPPH) and hydrogen peroxide scavenging methods, and determination of the total phenolic...

Author(s): Sibusisiwe Magama, Thabang Rants’o, Asita Okorie Asita and Matsepo Taole  

July 2018

Journal of Medicinal Plants Research
Towards accomplishing the roll back malaria initiative: Phytochemical screening and antimalarial activity of ethanolic leaf extract of Ricinus communis L. (Euphorbiaceae)

Malaria is a major debilitating disease caused by Plasmodium species and spread by female Anopheles mosquitoes. This research was conducted to determine the efficacy of ethanolic leaf extracts of Ricinus communis L. against Plasmodium berghei (NK65) infection in mice. Phytochemical components of the extract were analyzed and elucidated in order to reveal the constituents with antimalarial potentials. The safety of the...

Author(s): Abdulhamid Ahmed, Mansur Liadi Yusuf, Sulaiman Sani Kankara and Umar Lawal  

July 2018

Journal of Medicinal Plants Research
Spermostatic activity of Eugenia brejoensis and Myroxylon peruiferum essential oils toward human spermatozoa

In this study, the in vitro spermostatic action, hemolytic action in combination of parabens of two essential oils (EOs) from Eugenia brejoensis Mazin (Myrtaceae, EbEO) and Myroxylon peruiferum L. (Fabaceae, MpEO) is reported, in addition to the first chemical characterization of MpEO. The EOs were obtained by hydrodistillation and characterized by gas chromatography-mass spectrometry (GC-MS). Different concentrations...

Author(s): José Adelson Alves do Nascimento Junior, Clovis Macêdo Bezerra Filho, Thiago Henrique Florencio de Oliveira, Alexandre Gomes da Silva, Patricia Cristina Bezerra-Silva, Patricia Maria Guedes Paiva, Marcia Vanusa da Silva, Daniela Maria do Amaral Ferraz Navarro, Luis Claudio Nascimento da Silva, and Maria Tereza dos Santos Correia,

July 2018

African Journal of Pharmacy and Pharmacology
Antioxidant activity of selenium on bisphenol-induced apoptosis and testicular toxicity of rats

Bisphenol A (BPA) is an industrial chemical widely used to make polycarbonate plastics for packaging and epoxy resins. This study sought to examine how selenium (Se) affects BPA toxicity in terms of albino rats’ histological structure, antioxidant enzymes, sexual hormones, and reproductive organs (seminiferous tubule (coiled tubule) diameter, epithelial height and sperm count). Adult male rats were divided into...

Author(s): Wael M. Al-Amoudi  

Page 8 of 1135, showing 50 records out of 56709 total, starting on record 351, ending on 400